EMAIL THIS PAGE TO A FRIEND

KSR1

kinase suppressor of ras 1

160 Gene Product Result for
Synonyms: KSR RSU2
UniProtKB ID: Q8IVT5, Q13476
Gene ID:
Mouse(16706) kinase suppressor of ras 1
Rat(360573) kinase suppressor of ras 1
chicken(427839) kinase suppressor of ras 1
dog(610451) kinase suppressor of ras 1
domestic cat(101092156) kinase suppressor of ras 1
Horse(100071912) kinase suppressor of ras 1
cow(100138565) kinase suppressor of ras 1
Domestic Rabbit(100350586) kinase suppressor of ras 1
domestic guinea pig(100729725) kinase suppressor of ras 1
naked mole-rat(101698408) kinase suppressor of ras 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014238 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_290793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_290793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_290793 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014238 Rosetta Predictions human pricing
NM_001108284 Rosetta Predictions rat pricing
NM_013571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111238 predicted 1599
2 SASI_Hs01_00111239 predicted 1156
3 SASI_Hs01_00111240 predicted 1569
4 SASI_Hs01_00111241 predicted 1983
5 SASI_Hs01_00111242 predicted 2462
6 SASI_Hs01_00111243 predicted 2753
7 SASI_Hs01_00111244 predicted 2542
8 SASI_Hs01_00111245 predicted 1503
9 SASI_Hs01_00111246 predicted 2074
10 SASI_Hs02_00345278 predicted 2772
11 SASI_Hs01_00111247 predicted 1533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108284 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237139 predicted 2132
2 SASI_Rn02_00237140 predicted 2269
3 SASI_Rn02_00237141 predicted 1168
4 SASI_Rn02_00237142 predicted 2357
5 SASI_Rn02_00237143 predicted 1877
6 SASI_Rn02_00237144 predicted 2371
7 SASI_Rn02_00237145 predicted 2141
8 SASI_Rn02_00237146 predicted 2231
9 SASI_Rn02_00237147 predicted 1966
10 SASI_Rn02_00237148 predicted 1483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322309 predicted 2123
2 SASI_Mm01_00033177 predicted 404
3 SASI_Mm01_00033179 predicted 1048
4 SASI_Mm01_00033181 predicted 1873
5 SASI_Mm01_00033183 predicted 608
6 SASI_Mm01_00033184 predicted 1165
7 SASI_Mm02_00322310 predicted 2350
8 SASI_Mm02_00322311 predicted 2367
9 SASI_Mm02_00322312 predicted 2221
10 SASI_Mm02_00322313 predicted 1141
11 SASI_Mm01_00033176 predicted 1244
12 SASI_Mm01_00033178 predicted 562
13 SASI_Mm01_00033180 predicted 1973
14 SASI_Mm01_00033182 predicted 2375
15 SASI_Mm01_00033185 predicted 2067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014238
KSR1 MISSION shRNA Bacterial Glycerol Stock
kinase suppressor of ras 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-2323s21c1
Sequence:GTACCGGACGGCGTGAGAACCAGCTAAACTCGAGTTTAGCTGGTTCTCACGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014238.1-2787s21c1
Sequence:GTACCGGAGCACCGTGACTTCTGCTAAACTCGAGTTTAGCAGAAGTCACGGTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014238.1-3216s21c1
Sequence:CCGGCAACAAGGAGTGGAATGATTTCTCGAGAAATCATTCCACTCCTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1120s21c1
Sequence:CCGGGTGCCAGAAGAGCATGATATTCTCGAGAATATCATGCTCTTCTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-2220s21c1
Sequence:CCGGTCGTACACAAAGATCTCAAATCTCGAGATTTGAGATCTTTGTGTACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1990s21c1
Sequence:CCGGGCTCTTCAAGAAAGAGGTGATCTCGAGATCACCTCTTTCTTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1516s21c1
Sequence:GTACCGGTCATCATAGACAGCAGTTTATCTCGAGATAAACTGCTGTCTATGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1576s21c1
Sequence:CCGGCCTTATTGCAGAAAGTTTAAACTCGAGTTTAAACTTTCTGCAATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014238
KSR1 MISSION shRNA shRNA Plasmid DNA
kinase suppressor of ras 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-2323s21c1
Sequence:GTACCGGACGGCGTGAGAACCAGCTAAACTCGAGTTTAGCTGGTTCTCACGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014238.1-2787s21c1
Sequence:GTACCGGAGCACCGTGACTTCTGCTAAACTCGAGTTTAGCAGAAGTCACGGTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014238.1-3216s21c1
Sequence:CCGGCAACAAGGAGTGGAATGATTTCTCGAGAAATCATTCCACTCCTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1120s21c1
Sequence:CCGGGTGCCAGAAGAGCATGATATTCTCGAGAATATCATGCTCTTCTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-2220s21c1
Sequence:CCGGTCGTACACAAAGATCTCAAATCTCGAGATTTGAGATCTTTGTGTACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1990s21c1
Sequence:CCGGGCTCTTCAAGAAAGAGGTGATCTCGAGATCACCTCTTTCTTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1516s21c1
Sequence:GTACCGGTCATCATAGACAGCAGTTTATCTCGAGATAAACTGCTGTCTATGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1576s21c1
Sequence:CCGGCCTTATTGCAGAAAGTTTAAACTCGAGTTTAAACTTTCTGCAATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014238
KSR1 MISSION shRNA Lentiviral Transduction Particles
kinase suppressor of ras 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-2323s21c1
Sequence:GTACCGGACGGCGTGAGAACCAGCTAAACTCGAGTTTAGCTGGTTCTCACGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014238.1-2787s21c1
Sequence:GTACCGGAGCACCGTGACTTCTGCTAAACTCGAGTTTAGCAGAAGTCACGGTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014238.1-3216s21c1
Sequence:CCGGCAACAAGGAGTGGAATGATTTCTCGAGAAATCATTCCACTCCTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1120s21c1
Sequence:CCGGGTGCCAGAAGAGCATGATATTCTCGAGAATATCATGCTCTTCTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-2220s21c1
Sequence:CCGGTCGTACACAAAGATCTCAAATCTCGAGATTTGAGATCTTTGTGTACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1990s21c1
Sequence:CCGGGCTCTTCAAGAAAGAGGTGATCTCGAGATCACCTCTTTCTTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1516s21c1
Sequence:GTACCGGTCATCATAGACAGCAGTTTATCTCGAGATAAACTGCTGTCTATGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014238.1-1576s21c1
Sequence:CCGGCCTTATTGCAGAAAGTTTAAACTCGAGTTTAAACTTTCTGCAATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013571
KSR1 MISSION shRNA Bacterial Glycerol Stock
kinase suppressor of ras 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2266s21c1
Sequence:CCGGCCCGAGATCGTACGAGAAATGCTCGAGCATTTCTCGTACGATCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2075s21c1
Sequence:CCGGTCATCAAGGGCATGGGTTATCCTCGAGGATAACCCATGCCCTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2030s21c1
Sequence:CCGGAGACGTCTCTGGACATCAATACTCGAGTATTGATGTCCAGAGACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2050s1c1
Sequence:CCGGCATCAATAAGACTAGGCAGATCTCGAGATCTGCCTAGTCTTATTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-1245s21c1
Sequence:CCGGAGAGTCTGTCCCGTCAGATATCTCGAGATATCTGACGGGACAGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-313s1c1
Sequence:CCGGGCTGGTGAAATACATTTGCAACTCGAGTTGCAAATGTATTTCACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-1013s1c1
Sequence:CCGGCCGATGAAGTTTGAACTCCCTCTCGAGAGGGAGTTCAAACTTCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2092s1c1
Sequence:CCGGCATGGGTTATCTTCATGCAAACTCGAGTTTGCATGAAGATAACCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2683s1c1
Sequence:CCGGGTCCGGTAATCCAAAGATGTACTCGAGTACATCTTTGGATTACCGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013571
KSR1 MISSION shRNA shRNA Plasmid DNA
kinase suppressor of ras 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2266s21c1
Sequence:CCGGCCCGAGATCGTACGAGAAATGCTCGAGCATTTCTCGTACGATCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2075s21c1
Sequence:CCGGTCATCAAGGGCATGGGTTATCCTCGAGGATAACCCATGCCCTTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2030s21c1
Sequence:CCGGAGACGTCTCTGGACATCAATACTCGAGTATTGATGTCCAGAGACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2050s1c1
Sequence:CCGGCATCAATAAGACTAGGCAGATCTCGAGATCTGCCTAGTCTTATTGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-1245s21c1
Sequence:CCGGAGAGTCTGTCCCGTCAGATATCTCGAGATATCTGACGGGACAGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-313s1c1
Sequence:CCGGGCTGGTGAAATACATTTGCAACTCGAGTTGCAAATGTATTTCACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-1013s1c1
Sequence:CCGGCCGATGAAGTTTGAACTCCCTCTCGAGAGGGAGTTCAAACTTCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2092s1c1
Sequence:CCGGCATGGGTTATCTTCATGCAAACTCGAGTTTGCATGAAGATAACCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2683s1c1
Sequence:CCGGGTCCGGTAATCCAAAGATGTACTCGAGTACATCTTTGGATTACCGGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013571
KSR1 MISSION shRNA Lentiviral Transduction Particles
kinase suppressor of ras 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2266s21c1
Sequence:CCGGCCCGAGATCGTACGAGAAATGCTCGAGCATTTCTCGTACGATCTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2075s21c1
Sequence:CCGGTCATCAAGGGCATGGGTTATCCTCGAGGATAACCCATGCCCTTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-2030s21c1
Sequence:CCGGAGACGTCTCTGGACATCAATACTCGAGTATTGATGTCCAGAGACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2050s1c1
Sequence:CCGGCATCAATAAGACTAGGCAGATCTCGAGATCTGCCTAGTCTTATTGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013571.2-1245s21c1
Sequence:CCGGAGAGTCTGTCCCGTCAGATATCTCGAGATATCTGACGGGACAGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-313s1c1
Sequence:CCGGGCTGGTGAAATACATTTGCAACTCGAGTTGCAAATGTATTTCACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-1013s1c1
Sequence:CCGGCCGATGAAGTTTGAACTCCCTCTCGAGAGGGAGTTCAAACTTCATCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2092s1c1
Sequence:CCGGCATGGGTTATCTTCATGCAAACTCGAGTTTGCATGAAGATAACCCATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013571.1-2683s1c1
Sequence:CCGGGTCCGGTAATCCAAAGATGTACTCGAGTACATCTTTGGATTACCGGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_290793
VALIDATED
KSR1 MISSION shRNA Bacterial Glycerol Stock
kinase suppressor of ras 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000006226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290793.4-1922s1c1
Sequence:CCGGGCCTCCTTATTGCAGAAAGTTCTCGAGAACTTTCTGCAATAAGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290793.4-1852s1c1
Sequence:CCGGGCTGCCTACTTCATTCATCATCTCGAGATGATGAATGAAGTAGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_290793.4-1287s1c1
Sequence:CCGGGTGCCAGAAGAGCATGATATTCTCGAGAATATCATGCTCTTCTGGCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_290793.4-2340s1c1
Sequence:CCGGGCTCTTCAAGAAAGAGGTGATCTCGAGATCACCTCTTTCTTGAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_290793
VALIDATED
KSR1 MISSION shRNA shRNA Plasmid DNA
kinase suppressor of ras 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000006226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290793.4-1922s1c1
Sequence:CCGGGCCTCCTTATTGCAGAAAGTTCTCGAGAACTTTCTGCAATAAGGAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290793.4-1852s1c1
Sequence:CCGGGCTGCCTACTTCATTCATCATCTCGAGATGATGAATGAAGTAGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_290793.4-1287s1c1
Sequence:CCGGGTGCCAGAAGAGCATGATATTCTCGAGAATATCATGCTCTTCTGGCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_290793.4-2340s1c1
Sequence:CCGGGCTCTTCAAGAAAGAGGTGATCTCGAGATCACCTCTTTCTTGAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_290793
VALIDATED
KSR1 MISSION shRNA Lentiviral Transduction Particles
kinase suppressor of ras 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000006226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290793.4-1922s1c1
Sequence:CCGGGCCTCCTTATTGCAGAAAGTTCTCGAGAACTTTCTGCAATAAGGAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_290793.4-1852s1c1
Sequence:CCGGGCTGCCTACTTCATTCATCATCTCGAGATGATGAATGAAGTAGGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:XM_290793.4-1287s1c1
Sequence:CCGGGTGCCAGAAGAGCATGATATTCTCGAGAATATCATGCTCTTCTGGCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:XM_290793.4-2340s1c1
Sequence:CCGGGCTCTTCAAGAAAGAGGTGATCTCGAGATCACCTCTTTCTTGAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)