EMAIL THIS PAGE TO A FRIEND

KSR2

kinase suppressor of ras 2

197 Gene Product Result for
UniProtKB ID: Q6VAB6, A0PJT2, Q3B828, Q8N775
Gene ID:
Mouse(333050) kinase suppressor of ras 2
Rat(288691) kinase suppressor of ras 2
domestic guinea pig(100730958) kinase suppressor of ras 2
naked mole-rat(101710530) kinase suppressor of ras 2
sheep(101110179) kinase suppressor of ras 2
Domestic Rabbit(100350287) kinase suppressor of ras 2
Zebrafish(569127) kinase suppressor of ras 2
domestic cat(101091904) kinase suppressor of ras 2
cow(617325) kinase suppressor of ras 2
Horse(100055035) kinase suppressor of ras 2
dog(486291) kinase suppressor of ras 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173598 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173598 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173598 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001114545 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114545 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114545 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_285897 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_285897 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_285897 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173598 Rosetta Predictions human pricing
XM_001080090 Rosetta Predictions rat pricing
XM_222212 Rosetta Predictions rat pricing
NM_001034873 Rosetta Predictions mouse pricing
NM_001114545 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064711 predicted 1363
2 SASI_Hs02_00368449 predicted 1333
3 SASI_Hs01_00064712 predicted 2530
4 SASI_Hs01_00064714 predicted 1175
5 SASI_Hs01_00064715 predicted 2353
6 SASI_Hs01_00064716 predicted 2529
7 SASI_Hs01_00064717 predicted 1429
8 SASI_Hs01_00064718 predicted 1209
9 SASI_Hs02_00368450 predicted 2614
10 SASI_Hs02_00368451 predicted 2616
11 SASI_Hs01_00064710 predicted 966
12 SASI_Hs01_00064713 predicted 2049
13 SASI_Hs01_00064719 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366539 predicted 2227
2 SASI_Rn02_00366540 predicted 411
3 SASI_Rn02_00366541 predicted 2053
4 SASI_Rn02_00366542 predicted 1188
5 SASI_Rn02_00366543 predicted 2297
6 SASI_Rn02_00366544 predicted 2309
7 SASI_Rn02_00366545 predicted 398
8 SASI_Rn02_00366546 predicted 731
9 SASI_Rn02_00366547 predicted 2318
10 SASI_Rn02_00366548 predicted 2136
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380645 predicted 414
2 SASI_Rn02_00380646 predicted 1185
3 SASI_Rn02_00380647 predicted 938
4 SASI_Rn02_00380648 predicted 868
5 SASI_Rn02_00380649 predicted 828
6 SASI_Rn02_00380650 predicted 394
7 SASI_Rn02_00380651 predicted 1107
8 SASI_Rn02_00380652 predicted 724
9 SASI_Rn02_00380653 predicted 554
10 SASI_Rn02_00380654 predicted 610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146350 predicted 1504
2 SASI_Mm01_00146355 predicted 1477
3 SASI_Mm01_00146356 predicted 1502
4 SASI_Mm01_00146357 predicted 1287
5 SASI_Mm02_00289140 predicted 1249
6 SASI_Mm02_00289141 predicted 1492
7 SASI_Mm02_00289142 predicted 1154
8 SASI_Mm02_00289143 predicted 1307
9 SASI_Mm02_00289144 predicted 1552
10 SASI_Mm02_00289145 predicted 1440
11 SASI_Mm01_00146351 predicted 1207
12 SASI_Mm01_00146352 predicted 1927
13 SASI_Mm01_00146353 predicted 2009
14 SASI_Mm01_00146354 predicted 1629
15 SASI_Mm01_00146358 predicted 2041
16 SASI_Mm01_00146359 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114545 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308667 predicted 673
2 SASI_Mm02_00308668 predicted 649
3 SASI_Mm02_00308669 predicted 669
4 SASI_Mm02_00308670 predicted 457
5 SASI_Mm02_00308671 predicted 426
6 SASI_Mm02_00308672 predicted 663
7 SASI_Mm02_00308673 predicted 324
8 SASI_Mm02_00308674 predicted 476
9 SASI_Mm02_00308675 predicted 716
10 SASI_Mm02_00308676 predicted 615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173598
VALIDATED
KSR2 MISSION shRNA Bacterial Glycerol Stock
kinase suppressor of ras 2
Human
18 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-348s21c1
Sequence:GTACCGGTGTGCGAGACTGTGGAGAAATCTCGAGATTTCTCCACAGTCTCGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1293s21c1
Sequence:GTACCGGAGTTAAAGTGCCACAACAAATCTCGAGATTTGTTGTGGCACTTTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-2596s21c1
Sequence:GTACCGGCCAACCAGCAGAGGCAATAATCTCGAGATTATTGCCTCTGCTGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1000s21c1
Sequence:CCGGCGTAGGCAGCTGCGAGAACATCTCGAGATGTTCTCGCAGCTGCCTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-417s21c1
Sequence:CCGGGCCTCAGGAATGTCCACATGTCTCGAGACATGTGGACATTCCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-2193s21c1
Sequence:CCGGGTAAGGGACGGACGCTCTATTCTCGAGAATAGAGCGTCCGTCCCTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1416s21c1
Sequence:CCGGTACGGAAGCCACCTCGCTATTCTCGAGAATAGCGAGGTGGCTTCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173598.4-3046s21c1
Sequence:CCGGCAGCCAGGGTGATGCGTTATTCTCGAGAATAACGCATCACCCTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1925s1c1
Sequence:CCGGCCAGGCAGATTGCTCAAGAAACTCGAGTTTCTTGAGCAATCTGCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-1995s1c1
Sequence:CCGGCCTCAAGTCAAAGAACGTCTTCTCGAGAAGACGTTCTTTGACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-960s1c1
Sequence:CCGGCAAGTTAAAGTGCCACAACAACTCGAGTTGTTGTGGCACTTTAACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173598.2-1036s1c1
Sequence:CCGGGCAAGGTTAGTCCGGACAGAGCTCGAGCTCTGTCCGGACTAACCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-669s1c1
Sequence:CCGGCGTAGGCAGCTGCGAGAACATCTCGAGATGTTCTCGCAGCTGCCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-86s1c1
Sequence:CCGGGCCTCAGGAATGTCCACATGTCTCGAGACATGTGGACATTCCTGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173598.2-2192s1c1
Sequence:CCGGCCAAGCACTCTGACGTCTTTGCTCGAGCAAAGACGTCAGAGTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1059s1c1
Sequence:CCGGCGTTCCGTGTGACATCAACAACTCGAGTTGTTGATGTCACACGGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1453s1c1
Sequence:CCGGCCATTACTTCAAATTGAAGTGCTCGAGCACTTCAATTTGAAGTAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-2215s1c1
Sequence:CCGGCTTGGCACAATCTGGTATGAACTCGAGTTCATACCAGATTGTGCCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173598
VALIDATED
KSR2 MISSION shRNA shRNA Plasmid DNA
kinase suppressor of ras 2
Human
18 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-348s21c1
Sequence:GTACCGGTGTGCGAGACTGTGGAGAAATCTCGAGATTTCTCCACAGTCTCGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1293s21c1
Sequence:GTACCGGAGTTAAAGTGCCACAACAAATCTCGAGATTTGTTGTGGCACTTTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-2596s21c1
Sequence:GTACCGGCCAACCAGCAGAGGCAATAATCTCGAGATTATTGCCTCTGCTGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1000s21c1
Sequence:CCGGCGTAGGCAGCTGCGAGAACATCTCGAGATGTTCTCGCAGCTGCCTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-417s21c1
Sequence:CCGGGCCTCAGGAATGTCCACATGTCTCGAGACATGTGGACATTCCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-2193s21c1
Sequence:CCGGGTAAGGGACGGACGCTCTATTCTCGAGAATAGAGCGTCCGTCCCTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1416s21c1
Sequence:CCGGTACGGAAGCCACCTCGCTATTCTCGAGAATAGCGAGGTGGCTTCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173598.4-3046s21c1
Sequence:CCGGCAGCCAGGGTGATGCGTTATTCTCGAGAATAACGCATCACCCTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1925s1c1
Sequence:CCGGCCAGGCAGATTGCTCAAGAAACTCGAGTTTCTTGAGCAATCTGCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-1995s1c1
Sequence:CCGGCCTCAAGTCAAAGAACGTCTTCTCGAGAAGACGTTCTTTGACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-960s1c1
Sequence:CCGGCAAGTTAAAGTGCCACAACAACTCGAGTTGTTGTGGCACTTTAACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173598.2-1036s1c1
Sequence:CCGGGCAAGGTTAGTCCGGACAGAGCTCGAGCTCTGTCCGGACTAACCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-669s1c1
Sequence:CCGGCGTAGGCAGCTGCGAGAACATCTCGAGATGTTCTCGCAGCTGCCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-86s1c1
Sequence:CCGGGCCTCAGGAATGTCCACATGTCTCGAGACATGTGGACATTCCTGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173598.2-2192s1c1
Sequence:CCGGCCAAGCACTCTGACGTCTTTGCTCGAGCAAAGACGTCAGAGTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1059s1c1
Sequence:CCGGCGTTCCGTGTGACATCAACAACTCGAGTTGTTGATGTCACACGGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1453s1c1
Sequence:CCGGCCATTACTTCAAATTGAAGTGCTCGAGCACTTCAATTTGAAGTAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-2215s1c1
Sequence:CCGGCTTGGCACAATCTGGTATGAACTCGAGTTCATACCAGATTGTGCCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173598
VALIDATED
KSR2 MISSION shRNA Lentiviral Transduction Particles
kinase suppressor of ras 2
Human
18 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-348s21c1
Sequence:GTACCGGTGTGCGAGACTGTGGAGAAATCTCGAGATTTCTCCACAGTCTCGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1293s21c1
Sequence:GTACCGGAGTTAAAGTGCCACAACAAATCTCGAGATTTGTTGTGGCACTTTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-2596s21c1
Sequence:GTACCGGCCAACCAGCAGAGGCAATAATCTCGAGATTATTGCCTCTGCTGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1000s21c1
Sequence:CCGGCGTAGGCAGCTGCGAGAACATCTCGAGATGTTCTCGCAGCTGCCTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-417s21c1
Sequence:CCGGGCCTCAGGAATGTCCACATGTCTCGAGACATGTGGACATTCCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-2193s21c1
Sequence:CCGGGTAAGGGACGGACGCTCTATTCTCGAGAATAGAGCGTCCGTCCCTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173598.4-1416s21c1
Sequence:CCGGTACGGAAGCCACCTCGCTATTCTCGAGAATAGCGAGGTGGCTTCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335901    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173598.4-3046s21c1
Sequence:CCGGCAGCCAGGGTGATGCGTTATTCTCGAGAATAACGCATCACCCTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1925s1c1
Sequence:CCGGCCAGGCAGATTGCTCAAGAAACTCGAGTTTCTTGAGCAATCTGCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-1995s1c1
Sequence:CCGGCCTCAAGTCAAAGAACGTCTTCTCGAGAAGACGTTCTTTGACTTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-960s1c1
Sequence:CCGGCAAGTTAAAGTGCCACAACAACTCGAGTTGTTGTGGCACTTTAACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199943    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173598.2-1036s1c1
Sequence:CCGGGCAAGGTTAGTCCGGACAGAGCTCGAGCTCTGTCCGGACTAACCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-669s1c1
Sequence:CCGGCGTAGGCAGCTGCGAGAACATCTCGAGATGTTCTCGCAGCTGCCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173598.2-86s1c1
Sequence:CCGGGCCTCAGGAATGTCCACATGTCTCGAGACATGTGGACATTCCTGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173598.2-2192s1c1
Sequence:CCGGCCAAGCACTCTGACGTCTTTGCTCGAGCAAAGACGTCAGAGTGCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1059s1c1
Sequence:CCGGCGTTCCGTGTGACATCAACAACTCGAGTTGTTGATGTCACACGGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-1453s1c1
Sequence:CCGGCCATTACTTCAAATTGAAGTGCTCGAGCACTTCAATTTGAAGTAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173598.2-2215s1c1
Sequence:CCGGCTTGGCACAATCTGGTATGAACTCGAGTTCATACCAGATTGTGCCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114545
KSR2 MISSION shRNA Bacterial Glycerol Stock
kinase suppressor of ras 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000378606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-2072s21c1
Sequence:CCGGCCATCCGGTTGATTGACATAGCTCGAGCTATGTCAATCAACCGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-1212s21c1
Sequence:CCGGACGCAGAGACCTTGGCAATTCCTCGAGGAATTGCCAAGGTCTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-2298s21c1
Sequence:CCGGGATCGCGCAAGAGATTGTAAACTCGAGTTTACAATCTCTTGCGCGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-1325s21c1
Sequence:CCGGGCAAGTTAAAGTGCCACAATACTCGAGTATTGTGGCACTTTAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114545
KSR2 MISSION shRNA shRNA Plasmid DNA
kinase suppressor of ras 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000378606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-2072s21c1
Sequence:CCGGCCATCCGGTTGATTGACATAGCTCGAGCTATGTCAATCAACCGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-1212s21c1
Sequence:CCGGACGCAGAGACCTTGGCAATTCCTCGAGGAATTGCCAAGGTCTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-2298s21c1
Sequence:CCGGGATCGCGCAAGAGATTGTAAACTCGAGTTTACAATCTCTTGCGCGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-1325s21c1
Sequence:CCGGGCAAGTTAAAGTGCCACAATACTCGAGTATTGTGGCACTTTAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114545
KSR2 MISSION shRNA Lentiviral Transduction Particles
kinase suppressor of ras 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000378606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-2072s21c1
Sequence:CCGGCCATCCGGTTGATTGACATAGCTCGAGCTATGTCAATCAACCGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-1212s21c1
Sequence:CCGGACGCAGAGACCTTGGCAATTCCTCGAGGAATTGCCAAGGTCTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-2298s21c1
Sequence:CCGGGATCGCGCAAGAGATTGTAAACTCGAGTTTACAATCTCTTGCGCGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114545.1-1325s21c1
Sequence:CCGGGCAAGTTAAAGTGCCACAATACTCGAGTATTGTGGCACTTTAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_285897
KSR2 MISSION shRNA Bacterial Glycerol Stock
kinase suppressor of ras 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-784s1c1
Sequence:CCGGCCGTTTGAACAGCTAGAGATTCTCGAGAATCTCTAGCTGTTCAAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-1101s1c1
Sequence:CCGGGCAAGAGATTGTAAAGGGCATCTCGAGATGCCCTTTACAATCTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-868s1c1
Sequence:CCGGGCCATCCGGTTGATTGACATACTCGAGTATGTCAATCAACCGGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-649s1c1
Sequence:CCGGGAGAACGAAGAGAGCCACAATCTCGAGATTGTGGCTCTCTTCGTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-96s1c1
Sequence:CCGGCTCCAAACAAGATTGGATCATCTCGAGATGATCCAATCTTGTTTGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_285897
KSR2 MISSION shRNA shRNA Plasmid DNA
kinase suppressor of ras 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-784s1c1
Sequence:CCGGCCGTTTGAACAGCTAGAGATTCTCGAGAATCTCTAGCTGTTCAAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-1101s1c1
Sequence:CCGGGCAAGAGATTGTAAAGGGCATCTCGAGATGCCCTTTACAATCTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-868s1c1
Sequence:CCGGGCCATCCGGTTGATTGACATACTCGAGTATGTCAATCAACCGGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-649s1c1
Sequence:CCGGGAGAACGAAGAGAGCCACAATCTCGAGATTGTGGCTCTCTTCGTTCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-96s1c1
Sequence:CCGGCTCCAAACAAGATTGGATCATCTCGAGATGATCCAATCTTGTTTGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_285897
KSR2 MISSION shRNA Lentiviral Transduction Particles
kinase suppressor of ras 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-784s1c1
Sequence:CCGGCCGTTTGAACAGCTAGAGATTCTCGAGAATCTCTAGCTGTTCAAACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-1101s1c1
Sequence:CCGGGCAAGAGATTGTAAAGGGCATCTCGAGATGCCCTTTACAATCTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-868s1c1
Sequence:CCGGGCCATCCGGTTGATTGACATACTCGAGTATGTCAATCAACCGGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-649s1c1
Sequence:CCGGGAGAACGAAGAGAGCCACAATCTCGAGATTGTGGCTCTCTTCGTTCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_285897.2-96s1c1
Sequence:CCGGCTCCAAACAAGATTGGATCATCTCGAGATGATCCAATCTTGTTTGGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)