EMAIL THIS PAGE TO A FRIEND

KTI12

KTI12 homolog, chromatin associated (S. cerevisiae)

51 Gene Product Result for
Synonyms: RP11-91A18.3 TOT4
UniProtKB ID: Q96EK9
Gene ID:
Mouse(100087) KTI12 homolog, chromatin associated (S. cerevisiae)
Rat(685656) KTI12 homolog, chromatin associated (S. cerevisiae)
Zebrafish(751662) KTI12 homolog, chromatin associated (S. cerevisiae)
cow(538901) KTI12 homolog, chromatin associated (S. cerevisiae)
domestic cat(101089881) KTI12 homolog, chromatin associated (S. cerevisiae)
dog(100688398) KTI12 homolog, chromatin associated (S. cerevisiae)
chicken(424637) KTI12 homolog, chromatin associated (S. cerevisiae)
sheep(101113710) KTI12 homolog, chromatin associated (S. cerevisiae)
domestic guinea pig(100723328) KTI12 homolog, chromatin associated (S. cerevisiae)
naked mole-rat(101714505) KTI12 homolog, chromatin associated (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138417 Rosetta Predictions human pricing
NM_001044288 Rosetta Predictions rat pricing
NM_029571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011438 predicted 1059
2 SASI_Hs01_00011440 predicted 1351
3 SASI_Hs01_00011441 predicted 681
4 SASI_Hs01_00011442 predicted 1266
5 SASI_Hs01_00011443 predicted 957
6 SASI_Hs01_00011444 predicted 599
7 SASI_Hs01_00011445 predicted 1271
8 SASI_Hs01_00011446 predicted 1132
9 SASI_Hs01_00011447 predicted 1290
10 SASI_Hs02_00363556 predicted 499
11 SASI_Hs01_00011439 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205554 predicted 617
2 SASI_Rn02_00205555 predicted 1011
3 SASI_Rn02_00205556 predicted 924
4 SASI_Rn02_00205557 predicted 1012
5 SASI_Rn02_00205558 predicted 1042
6 SASI_Rn02_00205559 predicted 545
7 SASI_Rn02_00205560 predicted 997
8 SASI_Rn02_00205561 predicted 1014
9 SASI_Rn02_00205562 predicted 954
10 SASI_Rn02_00205563 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093071 predicted 566
2 SASI_Mm01_00093072 predicted 1045
3 SASI_Mm01_00093073 predicted 1043
4 SASI_Mm01_00093074 predicted 814
5 SASI_Mm01_00093075 predicted 652
6 SASI_Mm01_00093077 predicted 1031
7 SASI_Mm01_00093078 predicted 1039
8 SASI_Mm01_00093079 predicted 708
9 SASI_Mm01_00093080 predicted 1232
10 SASI_Mm02_00335521 predicted 1119
11 SASI_Mm01_00093076 predicted 804
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029571
VALIDATED
KTI12 MISSION shRNA Bacterial Glycerol Stock
KTI12 homolog, chromatin associated (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-1050s1c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-995s1c1
Sequence:CCGGCCAGTTTATTTCCTACACCAACTCGAGTTGGTGTAGGAAATAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-1233s1c1
Sequence:CCGGCCTGAGTGTGTAGTTAGCATACTCGAGTATGCTAACTACACACTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029571.1-556s1c1
Sequence:CCGGCAGAGGAAATCCTGCCATCAACTCGAGTTGATGGCAGGATTTCCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-989s1c1
Sequence:CCGGCCGTCGCCAGTTTATTTCCTACTCGAGTAGGAAATAAACTGGCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1049s21c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-988s21c1
Sequence:CCGGCCGTCGCCAGTTTATTTCCTACTCGAGTAGGAAATAAACTGGCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1360s21c1
Sequence:CCGGGTGAGTAGAAACCGAAGATAACTCGAGTTATCTTCGGTTTCTACTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-331s21c1
Sequence:CCGGCACGCCGCTCTGCTTACTTTACTCGAGTAAAGTAAGCAGAGCGGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1017s21c1
Sequence:CCGGTGCATCCCAATAACGAGAATCCTCGAGGATTCTCGTTATTGGGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029571
VALIDATED
KTI12 MISSION shRNA shRNA Plasmid DNA
KTI12 homolog, chromatin associated (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-1050s1c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-995s1c1
Sequence:CCGGCCAGTTTATTTCCTACACCAACTCGAGTTGGTGTAGGAAATAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-1233s1c1
Sequence:CCGGCCTGAGTGTGTAGTTAGCATACTCGAGTATGCTAACTACACACTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029571.1-556s1c1
Sequence:CCGGCAGAGGAAATCCTGCCATCAACTCGAGTTGATGGCAGGATTTCCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-989s1c1
Sequence:CCGGCCGTCGCCAGTTTATTTCCTACTCGAGTAGGAAATAAACTGGCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1049s21c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-988s21c1
Sequence:CCGGCCGTCGCCAGTTTATTTCCTACTCGAGTAGGAAATAAACTGGCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1360s21c1
Sequence:CCGGGTGAGTAGAAACCGAAGATAACTCGAGTTATCTTCGGTTTCTACTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-331s21c1
Sequence:CCGGCACGCCGCTCTGCTTACTTTACTCGAGTAAAGTAAGCAGAGCGGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1017s21c1
Sequence:CCGGTGCATCCCAATAACGAGAATCCTCGAGGATTCTCGTTATTGGGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029571
VALIDATED
KTI12 MISSION shRNA Lentiviral Transduction Particles
KTI12 homolog, chromatin associated (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-1050s1c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-995s1c1
Sequence:CCGGCCAGTTTATTTCCTACACCAACTCGAGTTGGTGTAGGAAATAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-1233s1c1
Sequence:CCGGCCTGAGTGTGTAGTTAGCATACTCGAGTATGCTAACTACACACTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029571.1-556s1c1
Sequence:CCGGCAGAGGAAATCCTGCCATCAACTCGAGTTGATGGCAGGATTTCCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029571.1-989s1c1
Sequence:CCGGCCGTCGCCAGTTTATTTCCTACTCGAGTAGGAAATAAACTGGCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1049s21c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287968    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-988s21c1
Sequence:CCGGCCGTCGCCAGTTTATTTCCTACTCGAGTAGGAAATAAACTGGCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295324    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1360s21c1
Sequence:CCGGGTGAGTAGAAACCGAAGATAACTCGAGTTATCTTCGGTTTCTACTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-331s21c1
Sequence:CCGGCACGCCGCTCTGCTTACTTTACTCGAGTAAAGTAAGCAGAGCGGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029571.2-1017s21c1
Sequence:CCGGTGCATCCCAATAACGAGAATCCTCGAGGATTCTCGTTATTGGGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138417
KTI12 MISSION shRNA Bacterial Glycerol Stock
KTI12 homolog, chromatin associated (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-266s1c1
Sequence:CCGGCTACATCAAAGGTTTCCGTTACTCGAGTAACGGAAACCTTTGATGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-255s1c1
Sequence:CCGGGACTCGCTTAACTACATCAAACTCGAGTTTGATGTAGTTAAGCGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-1044s1c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138417.1-1038s1c1
Sequence:CCGGCAACTGGCCAACATGTTTCTTCTCGAGAAGAAACATGTTGGCCAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-493s1c1
Sequence:CCGGCGGACTCTGTAGTAAATGGAACTCGAGTTCCATTTACTACAGAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-985s1c1
Sequence:CCGGGTCGCCAGTTTATTTCGTACACTCGAGTGTACGAAATAAACTGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138417.2-947s21c1
Sequence:CCGGCCACAGAGCACTTGCGGTTTACTCGAGTAAACCGCAAGTGCTCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138417.2-1275s21c1
Sequence:CCGGCAGCATAAGTTCAGACTAAAGCTCGAGCTTTAGTCTGAACTTATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138417.2-1354s21c1
Sequence:CCGGGGACAGGGATTACCTAGATTGCTCGAGCAATCTAGGTAATCCCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138417.2-594s21c1
Sequence:CCCGAGCTCTTGTGACTCCGGATTCCTCGAGGAATCCGGAGTCACAAGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138417
KTI12 MISSION shRNA shRNA Plasmid DNA
KTI12 homolog, chromatin associated (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-266s1c1
Sequence:CCGGCTACATCAAAGGTTTCCGTTACTCGAGTAACGGAAACCTTTGATGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-255s1c1
Sequence:CCGGGACTCGCTTAACTACATCAAACTCGAGTTTGATGTAGTTAAGCGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-1044s1c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138417.1-1038s1c1
Sequence:CCGGCAACTGGCCAACATGTTTCTTCTCGAGAAGAAACATGTTGGCCAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-493s1c1
Sequence:CCGGCGGACTCTGTAGTAAATGGAACTCGAGTTCCATTTACTACAGAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-985s1c1
Sequence:CCGGGTCGCCAGTTTATTTCGTACACTCGAGTGTACGAAATAAACTGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138417.2-947s21c1
Sequence:CCGGCCACAGAGCACTTGCGGTTTACTCGAGTAAACCGCAAGTGCTCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138417.2-1275s21c1
Sequence:CCGGCAGCATAAGTTCAGACTAAAGCTCGAGCTTTAGTCTGAACTTATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138417.2-1354s21c1
Sequence:CCGGGGACAGGGATTACCTAGATTGCTCGAGCAATCTAGGTAATCCCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138417.2-594s21c1
Sequence:CCCGAGCTCTTGTGACTCCGGATTCCTCGAGGAATCCGGAGTCACAAGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138417
KTI12 MISSION shRNA Lentiviral Transduction Particles
KTI12 homolog, chromatin associated (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-266s1c1
Sequence:CCGGCTACATCAAAGGTTTCCGTTACTCGAGTAACGGAAACCTTTGATGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-255s1c1
Sequence:CCGGGACTCGCTTAACTACATCAAACTCGAGTTTGATGTAGTTAAGCGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-1044s1c1
Sequence:CCGGGCCAACATGTTTCTTCAGTATCTCGAGATACTGAAGAAACATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138417.1-1038s1c1
Sequence:CCGGCAACTGGCCAACATGTTTCTTCTCGAGAAGAAACATGTTGGCCAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-493s1c1
Sequence:CCGGCGGACTCTGTAGTAAATGGAACTCGAGTTCCATTTACTACAGAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138417.1-985s1c1
Sequence:CCGGGTCGCCAGTTTATTTCGTACACTCGAGTGTACGAAATAAACTGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138417.2-947s21c1
Sequence:CCGGCCACAGAGCACTTGCGGTTTACTCGAGTAAACCGCAAGTGCTCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138417.2-1275s21c1
Sequence:CCGGCAGCATAAGTTCAGACTAAAGCTCGAGCTTTAGTCTGAACTTATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138417.2-1354s21c1
Sequence:CCGGGGACAGGGATTACCTAGATTGCTCGAGCAATCTAGGTAATCCCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138417.2-594s21c1
Sequence:CCCGAGCTCTTGTGACTCCGGATTCCTCGAGGAATCCGGAGTCACAAGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)