EMAIL THIS PAGE TO A FRIEND

KTN1

kinectin 1 (kinesin receptor)

130 Gene Product Result for
Synonyms: CG1 KNT MU-RMS-40.19
UniProtKB ID: Q86UP2, Q13999, Q14707, Q15387, Q17RZ5, Q86W57
Gene ID:
Human(3895) Summary: This gene encodes an integral membrane protein that is a member of the kinectin protein family. The encoded protein is primarily localized to the endoplasmic reticulum membrane. This protein binds kinesin and may be involved in intracellular organelle motility. This protein also binds translation elongation factor-delta and may be involved in the assembly of the elongation factor-1 complex. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, Aug 2012]
Mouse(16709) kinectin 1
Rat(361029) kinectin 1 (kinesin receptor)
naked mole-rat(101725048) kinectin 1 (kinesin receptor)
sheep(101119479) kinectin 1 (kinesin receptor)
Zebrafish(368207) kinectin 1
domestic cat(101082241) kinectin 1 (kinesin receptor)
cow(537619) kinectin 1 (kinesin receptor)
Horse(100050521) kinectin 1 (kinesin receptor)
dog(480332) kinectin 1 (kinesin receptor)
chicken(396335) kinectin 1 (kinesin receptor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182926 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182926 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182926 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079521 Rosetta Predictions human pricing
NM_001079522 Rosetta Predictions human pricing
NM_004986 Rosetta Predictions human pricing
NM_182926 Rosetta Predictions human pricing
XM_001073656 Rosetta Predictions rat pricing
XM_341305 Rosetta Predictions rat pricing
NM_008477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079521 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313440 predicted 930
2 SASI_Hs02_00313441 predicted 1878
3 SASI_Hs02_00313442 predicted 2185
4 SASI_Hs02_00313443 predicted 893
5 SASI_Hs02_00313444 predicted 1725
6 SASI_Hs02_00313445 predicted 1370
7 SASI_Hs02_00313446 predicted 1757
8 SASI_Hs02_00313447 predicted 1426
9 SASI_Hs02_00313448 predicted 1231
10 SASI_Hs02_00313449 predicted 2233
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079522 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313450 predicted 1056
2 SASI_Hs02_00313451 predicted 1995
3 SASI_Hs02_00313452 predicted 2308
4 SASI_Hs02_00313453 predicted 1023
5 SASI_Hs02_00313454 predicted 1855
6 SASI_Hs02_00313455 predicted 1503
7 SASI_Hs02_00313456 predicted 1883
8 SASI_Hs02_00313457 predicted 1542
9 SASI_Hs02_00313458 predicted 1355
10 SASI_Hs02_00313459 predicted 2355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338699 predicted 934
2 SASI_Hs02_00338700 predicted 1871
3 SASI_Hs02_00338701 predicted 2191
4 SASI_Hs02_00338702 predicted 897
5 SASI_Hs02_00338703 predicted 1723
6 SASI_Hs02_00338704 predicted 1372
7 SASI_Hs02_00338705 predicted 1756
8 SASI_Hs02_00338706 predicted 1418
9 SASI_Hs02_00338707 predicted 1236
10 SASI_Hs02_00338708 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213513 predicted 1055
2 SASI_Hs01_00213514 predicted 2002
3 SASI_Hs02_00371060 predicted 2307
4 SASI_Hs01_00213515 predicted 1022
5 SASI_Hs02_00371061 predicted 1849
6 SASI_Hs01_00213517 predicted 1876
7 SASI_Hs01_00213519 predicted 1545
8 SASI_Hs01_00213520 predicted 1359
9 SASI_Hs02_00371062 predicted 2360
10 SASI_Hs01_00213521 predicted 1984
11 SASI_Hs01_00213516 predicted 2853
12 SASI_Hs01_00213518 predicted 928
13 SASI_Hs01_00213522 predicted 3839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343443 predicted 4232
2 SASI_Rn02_00343444 predicted 2175
3 SASI_Rn02_00343445 predicted 1375
4 SASI_Rn02_00343446 predicted 1793
5 SASI_Rn02_00343447 predicted 2071
6 SASI_Rn02_00343448 predicted 1252
7 SASI_Rn02_00343449 predicted 2920
8 SASI_Rn02_00343450 predicted 1850
9 SASI_Rn02_00343451 predicted 2688
10 SASI_Rn02_00343452 predicted 3399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392698 predicted 4225
2 SASI_Rn02_00392699 predicted 2174
3 SASI_Rn02_00392700 predicted 1369
4 SASI_Rn02_00392701 predicted 1799
5 SASI_Rn02_00392702 predicted 2069
6 SASI_Rn02_00392703 predicted 1249
7 SASI_Rn02_00392704 predicted 2916
8 SASI_Rn02_00392705 predicted 1849
9 SASI_Rn02_00392706 predicted 2682
10 SASI_Rn02_00392707 predicted 3405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313989 predicted 3818
2 SASI_Mm01_00183360 predicted 756
3 SASI_Mm01_00183361 predicted 2852
4 SASI_Mm02_00313990 predicted 632
5 SASI_Mm01_00183362 predicted 1890
6 SASI_Mm01_00183363 predicted 4042
7 SASI_Mm02_00313991 predicted 725
8 SASI_Mm01_00183368 predicted 3323
9 SASI_Mm01_00183369 predicted 2989
10 SASI_Mm02_00313992 predicted 2938
11 SASI_Mm01_00183364 predicted 1952
12 SASI_Mm01_00183365 predicted 3100
13 SASI_Mm01_00183366 predicted 728
14 SASI_Mm01_00183367 predicted 2321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182926
VALIDATED
KTN1 MISSION shRNA Bacterial Glycerol Stock
kinectin 1 (kinesin receptor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-3501s21c1
Sequence:CCGGGCTGTTGAGTTGGAGGCTAAACTCGAGTTTAGCCTCCAACTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-979s21c1
Sequence:CCGGCCCTTATTCATGCAACTACTTCTCGAGAAGTAGTTGCATGAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-2181s21c1
Sequence:CCGGCGTGATCGTTTAACAAGTAAACTCGAGTTTACTTGTTAAACGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-4324s21c1
Sequence:CCGGCGGTAAACCAACAGCTCACAACTCGAGTTGTGAGCTGTTGGTTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-2680s21c1
Sequence:CCGGCCTCTCTAGTTGAAGAACTTACTCGAGTAAGTTCTTCAACTAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182926.1-864s1c1
Sequence:CCGGCCCTTATTCATGCAACTACTTCTCGAGAAGTAGTTGCATGAATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-3386s1c1
Sequence:CCGGGCTGTTGAGTTGGAGGCTAAACTCGAGTTTAGCCTCCAACTCAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-2565s1c1
Sequence:CCGGCCTCTCTAGTTGAAGAACTTACTCGAGTAAGTTCTTCAACTAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-4209s1c1
Sequence:CCGGCGGTAAACCAACAGCTCACAACTCGAGTTGTGAGCTGTTGGTTTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-2066s1c1
Sequence:CCGGCGTGATCGTTTAACAAGTAAACTCGAGTTTACTTGTTAAACGATCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182926
VALIDATED
KTN1 MISSION shRNA shRNA Plasmid DNA
kinectin 1 (kinesin receptor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-3501s21c1
Sequence:CCGGGCTGTTGAGTTGGAGGCTAAACTCGAGTTTAGCCTCCAACTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-979s21c1
Sequence:CCGGCCCTTATTCATGCAACTACTTCTCGAGAAGTAGTTGCATGAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-2181s21c1
Sequence:CCGGCGTGATCGTTTAACAAGTAAACTCGAGTTTACTTGTTAAACGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-4324s21c1
Sequence:CCGGCGGTAAACCAACAGCTCACAACTCGAGTTGTGAGCTGTTGGTTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-2680s21c1
Sequence:CCGGCCTCTCTAGTTGAAGAACTTACTCGAGTAAGTTCTTCAACTAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182926.1-864s1c1
Sequence:CCGGCCCTTATTCATGCAACTACTTCTCGAGAAGTAGTTGCATGAATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-3386s1c1
Sequence:CCGGGCTGTTGAGTTGGAGGCTAAACTCGAGTTTAGCCTCCAACTCAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-2565s1c1
Sequence:CCGGCCTCTCTAGTTGAAGAACTTACTCGAGTAAGTTCTTCAACTAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-4209s1c1
Sequence:CCGGCGGTAAACCAACAGCTCACAACTCGAGTTGTGAGCTGTTGGTTTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-2066s1c1
Sequence:CCGGCGTGATCGTTTAACAAGTAAACTCGAGTTTACTTGTTAAACGATCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182926
VALIDATED
KTN1 MISSION shRNA Lentiviral Transduction Particles
kinectin 1 (kinesin receptor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-3501s21c1
Sequence:CCGGGCTGTTGAGTTGGAGGCTAAACTCGAGTTTAGCCTCCAACTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-979s21c1
Sequence:CCGGCCCTTATTCATGCAACTACTTCTCGAGAAGTAGTTGCATGAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-2181s21c1
Sequence:CCGGCGTGATCGTTTAACAAGTAAACTCGAGTTTACTTGTTAAACGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-4324s21c1
Sequence:CCGGCGGTAAACCAACAGCTCACAACTCGAGTTGTGAGCTGTTGGTTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182926.2-2680s21c1
Sequence:CCGGCCTCTCTAGTTGAAGAACTTACTCGAGTAAGTTCTTCAACTAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182926.1-864s1c1
Sequence:CCGGCCCTTATTCATGCAACTACTTCTCGAGAAGTAGTTGCATGAATAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-3386s1c1
Sequence:CCGGGCTGTTGAGTTGGAGGCTAAACTCGAGTTTAGCCTCCAACTCAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-2565s1c1
Sequence:CCGGCCTCTCTAGTTGAAGAACTTACTCGAGTAAGTTCTTCAACTAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-4209s1c1
Sequence:CCGGCGGTAAACCAACAGCTCACAACTCGAGTTGTGAGCTGTTGGTTTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_182926.1-2066s1c1
Sequence:CCGGCGTGATCGTTTAACAAGTAAACTCGAGTTTACTTGTTAAACGATCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008477
VALIDATED
KTN1 MISSION shRNA Bacterial Glycerol Stock
kinectin 1 (kinesin receptor)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008477.2-4317s1c1
Sequence:CCGGCAGAAGATCAAAGTGGTATAGCTCGAGCTATACCACTTTGATCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008477.2-4080s1c1
Sequence:CCGGGCCAAATTAAAGCCTTATTTACTCGAGTAAATAAGGCTTTAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.2-65s1c1
Sequence:CCGGCTCATCCCTTCAGTAGTTATTCTCGAGAATAACTACTGAAGGGATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-2623s1c1
Sequence:CCGGGCAGAACTTATTAAGAGGCAACTCGAGTTGCCTCTTAATAAGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008477.1-2966s1c1
Sequence:CCGGGAAATAACTGATCTCTGCAATCTCGAGATTGCAGAGATCAGTTATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-1148s1c1
Sequence:CCGGGCAAGAATGAAAGATCGGATTCTCGAGAATCCGATCTTTCATTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.1-332s1c1
Sequence:CCGGGCAGAAACTTCCAGTAGTGTTCTCGAGAACACTACTGGAAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-1898s1c1
Sequence:CCGGGCGAATGAACAGGATCACTTACTCGAGTAAGTGATCCTGTTCATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008477.1-2921s1c1
Sequence:CCGGCCCTCTCAGGAAGAATTACAACTCGAGTTGTAATTCTTCCTGAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.1-3454s1c1
Sequence:CCGGCGAGTCTCAAAGGATGATTAACTCGAGTTAATCATCCTTTGAGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008477
VALIDATED
KTN1 MISSION shRNA shRNA Plasmid DNA
kinectin 1 (kinesin receptor)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008477.2-4317s1c1
Sequence:CCGGCAGAAGATCAAAGTGGTATAGCTCGAGCTATACCACTTTGATCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008477.2-4080s1c1
Sequence:CCGGGCCAAATTAAAGCCTTATTTACTCGAGTAAATAAGGCTTTAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.2-65s1c1
Sequence:CCGGCTCATCCCTTCAGTAGTTATTCTCGAGAATAACTACTGAAGGGATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-2623s1c1
Sequence:CCGGGCAGAACTTATTAAGAGGCAACTCGAGTTGCCTCTTAATAAGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008477.1-2966s1c1
Sequence:CCGGGAAATAACTGATCTCTGCAATCTCGAGATTGCAGAGATCAGTTATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-1148s1c1
Sequence:CCGGGCAAGAATGAAAGATCGGATTCTCGAGAATCCGATCTTTCATTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.1-332s1c1
Sequence:CCGGGCAGAAACTTCCAGTAGTGTTCTCGAGAACACTACTGGAAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-1898s1c1
Sequence:CCGGGCGAATGAACAGGATCACTTACTCGAGTAAGTGATCCTGTTCATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008477.1-2921s1c1
Sequence:CCGGCCCTCTCAGGAAGAATTACAACTCGAGTTGTAATTCTTCCTGAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.1-3454s1c1
Sequence:CCGGCGAGTCTCAAAGGATGATTAACTCGAGTTAATCATCCTTTGAGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008477
VALIDATED
KTN1 MISSION shRNA Lentiviral Transduction Particles
kinectin 1 (kinesin receptor)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215699    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008477.2-4317s1c1
Sequence:CCGGCAGAAGATCAAAGTGGTATAGCTCGAGCTATACCACTTTGATCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216417    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_008477.2-4080s1c1
Sequence:CCGGGCCAAATTAAAGCCTTATTTACTCGAGTAAATAAGGCTTTAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.2-65s1c1
Sequence:CCGGCTCATCCCTTCAGTAGTTATTCTCGAGAATAACTACTGAAGGGATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-2623s1c1
Sequence:CCGGGCAGAACTTATTAAGAGGCAACTCGAGTTGCCTCTTAATAAGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008477.1-2966s1c1
Sequence:CCGGGAAATAACTGATCTCTGCAATCTCGAGATTGCAGAGATCAGTTATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-1148s1c1
Sequence:CCGGGCAAGAATGAAAGATCGGATTCTCGAGAATCCGATCTTTCATTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.1-332s1c1
Sequence:CCGGGCAGAAACTTCCAGTAGTGTTCTCGAGAACACTACTGGAAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008477.1-1898s1c1
Sequence:CCGGGCGAATGAACAGGATCACTTACTCGAGTAAGTGATCCTGTTCATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008477.1-2921s1c1
Sequence:CCGGCCCTCTCAGGAAGAATTACAACTCGAGTTGTAATTCTTCCTGAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193732    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_008477.1-3454s1c1
Sequence:CCGGCGAGTCTCAAAGGATGATTAACTCGAGTTAATCATCCTTTGAGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)