EMAIL THIS PAGE TO A FRIEND

KU-MEL-3

40 Gene Product Result for
Species: Human KU-MEL-3(497048)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011540 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011540 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011540 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011540 Rosetta Predictions human pricing
XR_040424 Rosetta Predictions human pricing
XR_040425 Rosetta Predictions human pricing
XR_040426 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208043 predicted 374
2 SASI_Hs01_00208044 predicted 316
3 SASI_Hs01_00208045 predicted 497
4 SASI_Hs01_00208046 predicted 347
5 SASI_Hs01_00208047 predicted 350
6 SASI_Hs01_00208048 predicted 597
7 SASI_Hs01_00208049 predicted 257
8 SASI_Hs01_00208050 predicted 347
9 SASI_Hs01_00208051 predicted 244
10 SASI_Hs01_00208052 predicted 383
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518741 predicted 180
2 SASI_Hs02_00518742 predicted 26
3 SASI_Hs02_00518743 predicted 170
4 SASI_Hs02_00518744 predicted 181
5 SASI_Hs02_00518745 predicted 77
6 SASI_Hs02_00518746 predicted 80
7 SASI_Hs02_00518747 predicted 202
8 SASI_Hs02_00518748 predicted 178
9 SASI_Hs02_00518749 predicted 74
10 SASI_Hs02_00518750 predicted 182
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040425 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518751 predicted 179
2 SASI_Hs02_00518752 predicted 22
3 SASI_Hs02_00518753 predicted 179
4 SASI_Hs02_00518754 predicted 178
5 SASI_Hs02_00518755 predicted 75
6 SASI_Hs02_00518756 predicted 77
7 SASI_Hs02_00518757 predicted 202
8 SASI_Hs02_00518758 predicted 179
9 SASI_Hs02_00518759 predicted 66
10 SASI_Hs02_00518760 predicted 181
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518761 predicted 186
2 SASI_Hs02_00518762 predicted 26
3 SASI_Hs02_00518763 predicted 179
4 SASI_Hs02_00518764 predicted 180
5 SASI_Hs02_00518765 predicted 83
6 SASI_Hs02_00518766 predicted 80
7 SASI_Hs02_00518767 predicted 205
8 SASI_Hs02_00518768 predicted 179
9 SASI_Hs02_00518769 predicted 75
10 SASI_Hs02_00518770 predicted 183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011540
KU-MEL-3 MISSION shRNA Bacterial Glycerol Stock
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011540.1-294s1c2
Sequence:CCGGCCCTGTCTCTAACTTCACCATCTCGAGATGGTGAAGTTAGAGACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011540.1-238s1c1
Sequence:CCGGCCTCTGCTCTACACTCATCTTCTCGAGAAGATGAGTGTAGAGCAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-343s1c1
Sequence:CCGGCCTCTCCAACACTGTTTGGAACTCGAGTTCCAAACAGTGTTGGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-408s1c1
Sequence:CCGGGCTGTTCATAAGGAGAGAGAACTCGAGTTCTCTCTCCTTATGAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-851s1c1
Sequence:CCGGGCAGCAAGCAAACATGGGTTTCTCGAGAAACCCATGTTTGCTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011540
KU-MEL-3 MISSION shRNA shRNA Plasmid DNA
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011540.1-294s1c2
Sequence:CCGGCCCTGTCTCTAACTTCACCATCTCGAGATGGTGAAGTTAGAGACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000188155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011540.1-238s1c1
Sequence:CCGGCCTCTGCTCTACACTCATCTTCTCGAGAAGATGAGTGTAGAGCAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-343s1c1
Sequence:CCGGCCTCTCCAACACTGTTTGGAACTCGAGTTCCAAACAGTGTTGGAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-408s1c1
Sequence:CCGGGCTGTTCATAAGGAGAGAGAACTCGAGTTCTCTCTCCTTATGAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-851s1c1
Sequence:CCGGGCAGCAAGCAAACATGGGTTTCTCGAGAAACCCATGTTTGCTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011540
KU-MEL-3 MISSION shRNA Lentiviral Transduction Particles
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011540.1-294s1c2
Sequence:CCGGCCCTGTCTCTAACTTCACCATCTCGAGATGGTGAAGTTAGAGACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000188155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001011540.1-238s1c1
Sequence:CCGGCCTCTGCTCTACACTCATCTTCTCGAGAAGATGAGTGTAGAGCAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166764    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-343s1c1
Sequence:CCGGCCTCTCCAACACTGTTTGGAACTCGAGTTCCAAACAGTGTTGGAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163223    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-408s1c1
Sequence:CCGGGCTGTTCATAAGGAGAGAGAACTCGAGTTCTCTCTCCTTATGAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165259    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001011540.1-851s1c1
Sequence:CCGGGCAGCAAGCAAACATGGGTTTCTCGAGAAACCCATGTTTGCTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)