EMAIL THIS PAGE TO A FRIEND

KXD1

KxDL motif containing 1

68 Gene Product Result for
Synonyms: C19orf50 KXDL MST096 MSTP096
UniProtKB ID: Q9BQD3, O76098
Gene ID:
Mouse(75620) KxDL motif containing 1
Rat(498606) KxDL motif containing 1
sheep(101108222) KxDL motif containing 1
domestic guinea pig(100735720) KxDL motif containing 1
naked mole-rat(101698876) KxDL motif containing 1
Zebrafish(445075) KxDL motif containing 1
cow(534253) KxDL motif containing 1
domestic cat(101088063) KxDL motif containing 1
dog(476666) KxDL motif containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024069 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029366 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029366 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029366 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124101 MISSION® esiRNA esiRNA human C19orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024069 Rosetta Predictions human pricing
NM_001025143 Rosetta Predictions rat pricing
XM_979156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054035 predicted 370
2 SASI_Hs01_00054036 predicted 1139
3 SASI_Hs01_00054037 predicted 968
4 SASI_Hs02_00356532 predicted 1165
5 SASI_Hs01_00054038 predicted 1142
6 SASI_Hs01_00054039 predicted 381
7 SASI_Hs01_00054040 predicted 976
8 SASI_Hs01_00054041 predicted 248
9 SASI_Hs01_00054042 predicted 690
10 SASI_Hs01_00054043 predicted 505
11 SASI_Hs01_00054044 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090927 predicted 611
2 SASI_Rn01_00090928 predicted 246
3 SASI_Rn01_00090929 predicted 774
4 SASI_Rn01_00090930 predicted 486
5 SASI_Rn01_00090931 predicted 404
6 SASI_Rn01_00090932 predicted 458
7 SASI_Rn01_00090934 predicted 462
8 SASI_Rn01_00090935 predicted 637
9 SASI_Rn01_00090936 predicted 849
10 SASI_Rn02_00203069 predicted 822
11 SASI_Rn01_00090933 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218917 predicted 782
2 SASI_Mm01_00218918 predicted 876
3 SASI_Mm01_00218919 predicted 1002
4 SASI_Mm01_00218920 predicted 636
5 SASI_Mm01_00218921 predicted 524
6 SASI_Mm01_00218922 predicted 496
7 SASI_Mm01_00218923 predicted 668
8 SASI_Mm01_00218924 predicted 521
9 SASI_Mm01_00218925 predicted 630
10 SASI_Mm01_00218926 predicted 530
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024069
VALIDATED
KXD1 MISSION shRNA Bacterial Glycerol Stock
KxDL motif containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-271s1c1
Sequence:CCGGGATGCTGCTCAACTTCAACAACTCGAGTTGTTGAAGTTGAGCAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-265s1c1
Sequence:CCGGCAATGAGATGCTGCTCAACTTCTCGAGAAGTTGAGCAGCATCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-197s1c1
Sequence:CCGGGTGAACACAGATGATGTCAACCTCGAGGTTGACATCATCTGTGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-248s1c1
Sequence:CCGGGACCGCTTTGAGAAGACCAATCTCGAGATTGGTCTTCTCAAAGCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-262s1c1
Sequence:CCGGGACCAATGAGATGCTGCTCAACTCGAGTTGAGCAGCATCTCATTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-192s1c1
Sequence:CCGGGCATGGTGAACACAGATGATGCTCGAGCATCATCTGTGTTCACCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-264s1c1
Sequence:CCGGCCAATGAGATGCTGCTCAACTCTCGAGAGTTGAGCAGCATCTCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-274s1c1
Sequence:CCGGGCTGCTCAACTTCAACAACCTCTCGAGAGGTTGTTGAAGTTGAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-1238s1c1
Sequence:CCGGGAGTTCTGTGTTTCTCTGAATCTCGAGATTCAGAGAAACACAGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024069
VALIDATED
KXD1 MISSION shRNA shRNA Plasmid DNA
KxDL motif containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-271s1c1
Sequence:CCGGGATGCTGCTCAACTTCAACAACTCGAGTTGTTGAAGTTGAGCAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-265s1c1
Sequence:CCGGCAATGAGATGCTGCTCAACTTCTCGAGAAGTTGAGCAGCATCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-197s1c1
Sequence:CCGGGTGAACACAGATGATGTCAACCTCGAGGTTGACATCATCTGTGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-248s1c1
Sequence:CCGGGACCGCTTTGAGAAGACCAATCTCGAGATTGGTCTTCTCAAAGCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-262s1c1
Sequence:CCGGGACCAATGAGATGCTGCTCAACTCGAGTTGAGCAGCATCTCATTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-192s1c1
Sequence:CCGGGCATGGTGAACACAGATGATGCTCGAGCATCATCTGTGTTCACCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-264s1c1
Sequence:CCGGCCAATGAGATGCTGCTCAACTCTCGAGAGTTGAGCAGCATCTCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-274s1c1
Sequence:CCGGGCTGCTCAACTTCAACAACCTCTCGAGAGGTTGTTGAAGTTGAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-1238s1c1
Sequence:CCGGGAGTTCTGTGTTTCTCTGAATCTCGAGATTCAGAGAAACACAGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024069
VALIDATED
KXD1 MISSION shRNA Lentiviral Transduction Particles
KxDL motif containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142360    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-271s1c1
Sequence:CCGGGATGCTGCTCAACTTCAACAACTCGAGTTGTTGAAGTTGAGCAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-265s1c1
Sequence:CCGGCAATGAGATGCTGCTCAACTTCTCGAGAAGTTGAGCAGCATCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142245    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-197s1c1
Sequence:CCGGGTGAACACAGATGATGTCAACCTCGAGGTTGACATCATCTGTGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-248s1c1
Sequence:CCGGGACCGCTTTGAGAAGACCAATCTCGAGATTGGTCTTCTCAAAGCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-262s1c1
Sequence:CCGGGACCAATGAGATGCTGCTCAACTCGAGTTGAGCAGCATCTCATTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-192s1c1
Sequence:CCGGGCATGGTGAACACAGATGATGCTCGAGCATCATCTGTGTTCACCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139379    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024069.2-264s1c1
Sequence:CCGGCCAATGAGATGCTGCTCAACTCTCGAGAGTTGAGCAGCATCTCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-274s1c1
Sequence:CCGGGCTGCTCAACTTCAACAACCTCTCGAGAGGTTGTTGAAGTTGAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145114    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_024069.2-1238s1c1
Sequence:CCGGGAGTTCTGTGTTTCTCTGAATCTCGAGATTCAGAGAAACACAGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029366
VALIDATED
KXD1 MISSION shRNA Bacterial Glycerol Stock
KxDL motif containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-206s21c1
Sequence:CCGGGATGATGTCAATGCCATAATCCTCGAGGATTATGGCATTGACATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-483s21c1
Sequence:CCGGACCCTATCCCACCCAGTATCACTCGAGTGATACTGGGTGGGATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029366.2-322s21c1
Sequence:CCGGTGAGCGCTTCATGCACCATACCTCGAGGTATGGTGCATGAAGCGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-443s21c1
Sequence:CCGGCACATCCCAGAGGGTTCATTCCTCGAGGAATGAACCCTCTGGGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-762s21c1
Sequence:CCGGCATAGGCAGGATTCCTAATTCCTCGAGGAATTAGGAATCCTGCCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029366
VALIDATED
KXD1 MISSION shRNA shRNA Plasmid DNA
KxDL motif containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-206s21c1
Sequence:CCGGGATGATGTCAATGCCATAATCCTCGAGGATTATGGCATTGACATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-483s21c1
Sequence:CCGGACCCTATCCCACCCAGTATCACTCGAGTGATACTGGGTGGGATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029366.2-322s21c1
Sequence:CCGGTGAGCGCTTCATGCACCATACCTCGAGGTATGGTGCATGAAGCGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-443s21c1
Sequence:CCGGCACATCCCAGAGGGTTCATTCCTCGAGGAATGAACCCTCTGGGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-762s21c1
Sequence:CCGGCATAGGCAGGATTCCTAATTCCTCGAGGAATTAGGAATCCTGCCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029366
VALIDATED
KXD1 MISSION shRNA Lentiviral Transduction Particles
KxDL motif containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-206s21c1
Sequence:CCGGGATGATGTCAATGCCATAATCCTCGAGGATTATGGCATTGACATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-483s21c1
Sequence:CCGGACCCTATCCCACCCAGTATCACTCGAGTGATACTGGGTGGGATAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029366.2-322s21c1
Sequence:CCGGTGAGCGCTTCATGCACCATACCTCGAGGTATGGTGCATGAAGCGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-443s21c1
Sequence:CCGGCACATCCCAGAGGGTTCATTCCTCGAGGAATGAACCCTCTGGGATGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029366.2-762s21c1
Sequence:CCGGCATAGGCAGGATTCCTAATTCCTCGAGGAATTAGGAATCCTGCCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)