EMAIL THIS PAGE TO A FRIEND

KY

kyphoscoliosis peptidase

73 Gene Product Result for
UniProtKB ID: Q8NBH2, B7Z1S4, Q6ZT15
Gene ID:
Mouse(16716) kyphoscoliosis peptidase
Rat(315962) kyphoscoliosis peptidase
Zebrafish(795191) kyphoscoliosis peptidase
cow(781026) kyphoscoliosis peptidase
Horse(100053201) kyphoscoliosis peptidase
domestic cat(101086340) kyphoscoliosis peptidase
dog(485670) kyphoscoliosis peptidase
chicken(429137) kyphoscoliosis peptidase
domestic guinea pig(100723298) kyphoscoliosis peptidase
naked mole-rat(101725933) kyphoscoliosis peptidase
sheep(101113821) kyphoscoliosis peptidase
Domestic Rabbit(100338418) kyphoscoliosis peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU005841 MISSION® esiRNA esiRNA targeting human KY (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178554 Rosetta Predictions human pricing
NM_001108180 Rosetta Predictions rat pricing
NM_024291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245792 predicted 1240
2 SASI_Hs01_00245793 predicted 702
3 SASI_Hs01_00245795 predicted 440
4 SASI_Hs02_00369801 predicted 1696
5 SASI_Hs01_00245796 predicted 471
6 SASI_Hs02_00369802 predicted 1831
7 SASI_Hs01_00245797 predicted 511
8 SASI_Hs01_00245798 predicted 687
9 SASI_Hs01_00245800 predicted 1997
10 SASI_Hs01_00245801 predicted 1526
11 SASI_Hs01_00245794 predicted 329
12 SASI_Hs01_00245799 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108180 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236124 predicted 2122
2 SASI_Rn02_00236125 predicted 803
3 SASI_Rn02_00236126 predicted 434
4 SASI_Rn02_00236127 predicted 1162
5 SASI_Rn02_00236128 predicted 1017
6 SASI_Rn02_00236129 predicted 1898
7 SASI_Rn02_00236130 predicted 1985
8 SASI_Rn02_00236131 predicted 1480
9 SASI_Rn02_00236132 predicted 702
10 SASI_Rn02_00236133 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078399 predicted 1017
2 SASI_Mm02_00327717 predicted 1698
3 SASI_Mm01_00078400 predicted 1775
4 SASI_Mm01_00078401 predicted 1129
5 SASI_Mm01_00078403 predicted 1954
6 SASI_Mm01_00078404 predicted 1595
7 SASI_Mm02_00327718 predicted 321
8 SASI_Mm01_00078405 predicted 1293
9 SASI_Mm01_00078406 predicted 236
10 SASI_Mm01_00078407 predicted 1814
11 SASI_Mm01_00078402 predicted 444
12 SASI_Mm01_00078408 predicted 608
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178554
KY MISSION shRNA Bacterial Glycerol Stock
kyphoscoliosis peptidase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1699s21c1
Sequence:CCGGGAAACTACATCTTCGTCTTTACTCGAGTAAAGACGAAGATGTAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1837s21c1
Sequence:CCGGACCGGAATGTCCCATTCAAATCTCGAGATTTGAATGGGACATTCCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1294s21c1
Sequence:CCGGCTCACAAGCTGCAGATCTTTGCTCGAGCAAAGATCTGCAGCTTGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-472s21c1
Sequence:CCGGGGGATCGATCTAGCCTGAAATCTCGAGATTTCAGGCTAGATCGATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-395s21c1
Sequence:CCGGTAAACGTTTACAAGGTGATAACTCGAGTTATCACCTTGTAAACGTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-222s21c1
Sequence:CCGGGTCCGAAGATGGCAGAAATTACTCGAGTAATTTCTGCCATCTTCGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-852s1c1
Sequence:CCGGGAGTTTGACCATGCCTGGAATCTCGAGATTCCAGGCATGGTCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-1061s1c1
Sequence:CCGGGAGGCAGTTTGAGAACAACATCTCGAGATGTTGTTCTCAAACTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178554.3-643s1c1
Sequence:CCGGGCCATCACATAGAGTATGACACTCGAGTGTCATACTCTATGTGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-959s1c1
Sequence:CCGGCCTCTACAATGAGTTCTACTTCTCGAGAAGTAGAACTCATTGTAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-510s1c1
Sequence:CCGGCAGCAGTTTGAGAAATTGGATCTCGAGATCCAATTTCTCAAACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178554
KY MISSION shRNA shRNA Plasmid DNA
kyphoscoliosis peptidase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1699s21c1
Sequence:CCGGGAAACTACATCTTCGTCTTTACTCGAGTAAAGACGAAGATGTAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1837s21c1
Sequence:CCGGACCGGAATGTCCCATTCAAATCTCGAGATTTGAATGGGACATTCCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1294s21c1
Sequence:CCGGCTCACAAGCTGCAGATCTTTGCTCGAGCAAAGATCTGCAGCTTGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-472s21c1
Sequence:CCGGGGGATCGATCTAGCCTGAAATCTCGAGATTTCAGGCTAGATCGATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-395s21c1
Sequence:CCGGTAAACGTTTACAAGGTGATAACTCGAGTTATCACCTTGTAAACGTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-222s21c1
Sequence:CCGGGTCCGAAGATGGCAGAAATTACTCGAGTAATTTCTGCCATCTTCGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000131189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-852s1c1
Sequence:CCGGGAGTTTGACCATGCCTGGAATCTCGAGATTCCAGGCATGGTCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-1061s1c1
Sequence:CCGGGAGGCAGTTTGAGAACAACATCTCGAGATGTTGTTCTCAAACTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178554.3-643s1c1
Sequence:CCGGGCCATCACATAGAGTATGACACTCGAGTGTCATACTCTATGTGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-959s1c1
Sequence:CCGGCCTCTACAATGAGTTCTACTTCTCGAGAAGTAGAACTCATTGTAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-510s1c1
Sequence:CCGGCAGCAGTTTGAGAAATTGGATCTCGAGATCCAATTTCTCAAACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178554
KY MISSION shRNA Lentiviral Transduction Particles
kyphoscoliosis peptidase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1699s21c1
Sequence:CCGGGAAACTACATCTTCGTCTTTACTCGAGTAAAGACGAAGATGTAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1837s21c1
Sequence:CCGGACCGGAATGTCCCATTCAAATCTCGAGATTTGAATGGGACATTCCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-1294s21c1
Sequence:CCGGCTCACAAGCTGCAGATCTTTGCTCGAGCAAAGATCTGCAGCTTGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-472s21c1
Sequence:CCGGGGGATCGATCTAGCCTGAAATCTCGAGATTTCAGGCTAGATCGATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-395s21c1
Sequence:CCGGTAAACGTTTACAAGGTGATAACTCGAGTTATCACCTTGTAAACGTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178554.4-222s21c1
Sequence:CCGGGTCCGAAGATGGCAGAAATTACTCGAGTAATTTCTGCCATCTTCGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000131189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-852s1c1
Sequence:CCGGGAGTTTGACCATGCCTGGAATCTCGAGATTCCAGGCATGGTCAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-1061s1c1
Sequence:CCGGGAGGCAGTTTGAGAACAACATCTCGAGATGTTGTTCTCAAACTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178554.3-643s1c1
Sequence:CCGGGCCATCACATAGAGTATGACACTCGAGTGTCATACTCTATGTGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-959s1c1
Sequence:CCGGCCTCTACAATGAGTTCTACTTCTCGAGAAGTAGAACTCATTGTAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178554.3-510s1c1
Sequence:CCGGCAGCAGTTTGAGAAATTGGATCTCGAGATCCAATTTCTCAAACTGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024291
KY MISSION shRNA Bacterial Glycerol Stock
kyphoscoliosis peptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1497s1c1
Sequence:CCGGGCGCTACATCTTCCAGTTGAACTCGAGTTCAACTGGAAGATGTAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1381s1c1
Sequence:CCGGCCTATCATTCACACCAGCGATCTCGAGATCGCTGGTGTGAATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-856s1c1
Sequence:CCGGCGTTTGGACCTCCTCTACAATCTCGAGATTGTAGAGGAGGTCCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-168s1c1
Sequence:CCGGCCAAGGTGTCAGAAACGGAATCTCGAGATTCCGTTTCTGACACCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1908s1c1
Sequence:CCGGCCACAACTTCTACAGCTACATCTCGAGATGTAGCTGTAGAAGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024291
KY MISSION shRNA shRNA Plasmid DNA
kyphoscoliosis peptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1497s1c1
Sequence:CCGGGCGCTACATCTTCCAGTTGAACTCGAGTTCAACTGGAAGATGTAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1381s1c1
Sequence:CCGGCCTATCATTCACACCAGCGATCTCGAGATCGCTGGTGTGAATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-856s1c1
Sequence:CCGGCGTTTGGACCTCCTCTACAATCTCGAGATTGTAGAGGAGGTCCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-168s1c1
Sequence:CCGGCCAAGGTGTCAGAAACGGAATCTCGAGATTCCGTTTCTGACACCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1908s1c1
Sequence:CCGGCCACAACTTCTACAGCTACATCTCGAGATGTAGCTGTAGAAGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024291
KY MISSION shRNA Lentiviral Transduction Particles
kyphoscoliosis peptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1497s1c1
Sequence:CCGGGCGCTACATCTTCCAGTTGAACTCGAGTTCAACTGGAAGATGTAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1381s1c1
Sequence:CCGGCCTATCATTCACACCAGCGATCTCGAGATCGCTGGTGTGAATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-856s1c1
Sequence:CCGGCGTTTGGACCTCCTCTACAATCTCGAGATTGTAGAGGAGGTCCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-168s1c1
Sequence:CCGGCCAAGGTGTCAGAAACGGAATCTCGAGATTCCGTTTCTGACACCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024291.1-1908s1c1
Sequence:CCGGCCACAACTTCTACAGCTACATCTCGAGATGTAGCTGTAGAAGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)