EMAIL THIS PAGE TO A FRIEND

KYNU

kynureninase

64 Gene Product Result for
UniProtKB ID: Q16719, B2RCZ5, D3DP79, Q6I9T2, Q9BVW3
Gene ID:
Human(8942) Summary: Kynureninase is a pyridoxal-5'-phosphate (pyridoxal-P) dependent enzyme that catalyzes the cleavage of L-kynurenine and L-3-hydroxykynurenine into anthranilic and 3-hydroxyanthranilic acids, respectively. Kynureninase is involved in the biosynthesis of NAD cofactors from tryptophan through the kynurenine pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
Mouse(70789) kynureninase (L-kynurenine hydrolase)
Rat(116682) kynureninase
sheep(101101867) kynureninase
chicken(424302) kynureninase
cow(520327) kynureninase
Horse(100057449) kynureninase
dog(483907) kynureninase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003937 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032998 Rosetta Predictions human pricing
NM_003937 Rosetta Predictions human pricing
NM_053902 Rosetta Predictions rat pricing
NM_027552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017364 predicted 539
2 SASI_Hs01_00017365 predicted 524
3 SASI_Hs01_00017366 predicted 479
4 SASI_Hs01_00017367 predicted 460
5 SASI_Hs01_00017368 predicted 620
6 SASI_Hs01_00017369 predicted 725
7 SASI_Hs01_00017370 predicted 518
8 SASI_Hs01_00017371 predicted 469
9 SASI_Hs01_00017372 predicted 290
10 SASI_Hs01_00017373 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224775 predicted 534
2 SASI_Hs01_00224776 predicted 522
3 SASI_Hs01_00224777 predicted 479
4 SASI_Hs01_00224778 predicted 463
5 SASI_Hs01_00224779 predicted 621
6 SASI_Hs01_00224780 predicted 733
7 SASI_Hs01_00224781 predicted 515
8 SASI_Hs01_00224782 predicted 469
9 SASI_Hs01_00224783 predicted 288
10 SASI_Hs01_00224784 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062057 predicted 261
2 SASI_Rn02_00266830 predicted 981
3 SASI_Rn01_00062058 predicted 363
4 SASI_Rn01_00062059 predicted 1526
5 SASI_Rn01_00062060 predicted 279
6 SASI_Rn01_00062061 predicted 1149
7 SASI_Rn01_00062062 predicted 398
8 SASI_Rn01_00062063 predicted 1166
9 SASI_Rn01_00062064 predicted 1367
10 SASI_Rn01_00062065 predicted 477
11 SASI_Rn01_00062056 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00036480 predicted 427
2 SASI_Mm01_00036481 predicted 1023
3 SASI_Mm02_00332393 predicted 589
4 SASI_Mm01_00036482 predicted 1070
5 SASI_Mm01_00036483 predicted 616
6 SASI_Mm01_00036485 predicted 1142
7 SASI_Mm01_00036486 predicted 1115
8 SASI_Mm01_00036487 predicted 440
9 SASI_Mm01_00036488 predicted 1409
10 SASI_Mm01_00036489 predicted 486
11 SASI_Mm01_00036484 predicted 1479
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003937
VALIDATED
KYNU MISSION shRNA Bacterial Glycerol Stock
kynureninase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-944s21c1
Sequence:CCGGTGGTGTTCCTACAAGTATTTACTCGAGTAAATACTTGTAGGAACACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-655s21c1
Sequence:CCGGACTACAACTTCACGGACTTAACTCGAGTTAAGTCCGTGAAGTTGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-1239s21c1
Sequence:CCGGACCTGATCAAGCATAACTATGCTCGAGCATAGTTATGCTTGATCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-1421s1c1
Sequence:CCGGCCTCTCTATAATTCTTTCCATCTCGAGATGGAAAGAATTATAGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-848s21c1
Sequence:CCGGGGACAAGCGAAGGGTTGTTATCTCGAGATAACAACCCTTCGCTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-1004s1c1
Sequence:CCGGCCTGCATTAGTGGGATGGTTTCTCGAGAAACCATCCCACTAATGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003937.1-308s1c1
Sequence:CCGGGCCATCTATTTCTTGGGAAATCTCGAGATTTCCCAAGAAATAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-793s1c1
Sequence:CCGGGCACTTTAATATTCCTGCCATCTCGAGATGGCAGGAATATTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003937.1-269s1c1
Sequence:CCGGCCTCCAGTTGATTTATCATTACTCGAGTAATGATAAATCAACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003937
VALIDATED
KYNU MISSION shRNA shRNA Plasmid DNA
kynureninase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-944s21c1
Sequence:CCGGTGGTGTTCCTACAAGTATTTACTCGAGTAAATACTTGTAGGAACACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-655s21c1
Sequence:CCGGACTACAACTTCACGGACTTAACTCGAGTTAAGTCCGTGAAGTTGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-1239s21c1
Sequence:CCGGACCTGATCAAGCATAACTATGCTCGAGCATAGTTATGCTTGATCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-1421s1c1
Sequence:CCGGCCTCTCTATAATTCTTTCCATCTCGAGATGGAAAGAATTATAGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-848s21c1
Sequence:CCGGGGACAAGCGAAGGGTTGTTATCTCGAGATAACAACCCTTCGCTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-1004s1c1
Sequence:CCGGCCTGCATTAGTGGGATGGTTTCTCGAGAAACCATCCCACTAATGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003937.1-308s1c1
Sequence:CCGGGCCATCTATTTCTTGGGAAATCTCGAGATTTCCCAAGAAATAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-793s1c1
Sequence:CCGGGCACTTTAATATTCCTGCCATCTCGAGATGGCAGGAATATTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003937.1-269s1c1
Sequence:CCGGCCTCCAGTTGATTTATCATTACTCGAGTAATGATAAATCAACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003937
VALIDATED
KYNU MISSION shRNA Lentiviral Transduction Particles
kynureninase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-944s21c1
Sequence:CCGGTGGTGTTCCTACAAGTATTTACTCGAGTAAATACTTGTAGGAACACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-655s21c1
Sequence:CCGGACTACAACTTCACGGACTTAACTCGAGTTAAGTCCGTGAAGTTGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-1239s21c1
Sequence:CCGGACCTGATCAAGCATAACTATGCTCGAGCATAGTTATGCTTGATCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-1421s1c1
Sequence:CCGGCCTCTCTATAATTCTTTCCATCTCGAGATGGAAAGAATTATAGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003937.2-848s21c1
Sequence:CCGGGGACAAGCGAAGGGTTGTTATCTCGAGATAACAACCCTTCGCTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-1004s1c1
Sequence:CCGGCCTGCATTAGTGGGATGGTTTCTCGAGAAACCATCCCACTAATGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003937.1-308s1c1
Sequence:CCGGGCCATCTATTTCTTGGGAAATCTCGAGATTTCCCAAGAAATAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003937.1-793s1c1
Sequence:CCGGGCACTTTAATATTCCTGCCATCTCGAGATGGCAGGAATATTAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_003937.1-269s1c1
Sequence:CCGGCCTCCAGTTGATTTATCATTACTCGAGTAATGATAAATCAACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027552
KYNU MISSION shRNA Bacterial Glycerol Stock
kynureninase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1068s21c1
Sequence:CCGGGGGCCAATGGATTCCGAATTTCTCGAGAAATTCGGAATCCATTGGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-286s21c1
Sequence:CCGGGGATGATGATGCCATCTATTTCTCGAGAAATAGATGGCATCATCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1112s21c1
Sequence:CCGGTGCTCCTTGCACGCCAGTTTACTCGAGTAAACTGGCGTGCAAGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1017s21c1
Sequence:CCGGATGACCTCAGTACAAGGTTTACTCGAGTAAACCTTGTACTGAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-518s1c1
Sequence:CCGGCATCTCCTGCTGTTATCATTCCTCGAGGAATGATAACAGCAGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-1476s1c1
Sequence:CCGGCAGAAAGAAGCTAGCTATATTCTCGAGAATATAGCTAGCTTCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027552.1-1777s21c1
Sequence:CCGGACTGAATTTCCAACGTTATAACTCGAGTTATAACGTTGGAAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027552.1-2491s1c1
Sequence:CCGGCCCTACAATGAATGCGGGTTACTCGAGTAACCCGCATTCATTGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-844s1c1
Sequence:CCGGCCTAGCACATGCAGTTGGAAACTCGAGTTTCCAACTGCATGTGCTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027552
KYNU MISSION shRNA shRNA Plasmid DNA
kynureninase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1068s21c1
Sequence:CCGGGGGCCAATGGATTCCGAATTTCTCGAGAAATTCGGAATCCATTGGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-286s21c1
Sequence:CCGGGGATGATGATGCCATCTATTTCTCGAGAAATAGATGGCATCATCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1112s21c1
Sequence:CCGGTGCTCCTTGCACGCCAGTTTACTCGAGTAAACTGGCGTGCAAGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1017s21c1
Sequence:CCGGATGACCTCAGTACAAGGTTTACTCGAGTAAACCTTGTACTGAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-518s1c1
Sequence:CCGGCATCTCCTGCTGTTATCATTCCTCGAGGAATGATAACAGCAGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-1476s1c1
Sequence:CCGGCAGAAAGAAGCTAGCTATATTCTCGAGAATATAGCTAGCTTCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027552.1-1777s21c1
Sequence:CCGGACTGAATTTCCAACGTTATAACTCGAGTTATAACGTTGGAAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027552.1-2491s1c1
Sequence:CCGGCCCTACAATGAATGCGGGTTACTCGAGTAACCCGCATTCATTGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-844s1c1
Sequence:CCGGCCTAGCACATGCAGTTGGAAACTCGAGTTTCCAACTGCATGTGCTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027552
KYNU MISSION shRNA Lentiviral Transduction Particles
kynureninase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1068s21c1
Sequence:CCGGGGGCCAATGGATTCCGAATTTCTCGAGAAATTCGGAATCCATTGGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-286s21c1
Sequence:CCGGGGATGATGATGCCATCTATTTCTCGAGAAATAGATGGCATCATCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1112s21c1
Sequence:CCGGTGCTCCTTGCACGCCAGTTTACTCGAGTAAACTGGCGTGCAAGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027552.1-1017s21c1
Sequence:CCGGATGACCTCAGTACAAGGTTTACTCGAGTAAACCTTGTACTGAGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-518s1c1
Sequence:CCGGCATCTCCTGCTGTTATCATTCCTCGAGGAATGATAACAGCAGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-1476s1c1
Sequence:CCGGCAGAAAGAAGCTAGCTATATTCTCGAGAATATAGCTAGCTTCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027552.1-1777s21c1
Sequence:CCGGACTGAATTTCCAACGTTATAACTCGAGTTATAACGTTGGAAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184752    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027552.1-2491s1c1
Sequence:CCGGCCCTACAATGAATGCGGGTTACTCGAGTAACCCGCATTCATTGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027552.1-844s1c1
Sequence:CCGGCCTAGCACATGCAGTTGGAAACTCGAGTTTCCAACTGCATGTGCTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)