EMAIL THIS PAGE TO A FRIEND

L1TD1

LINE-1 type transposase domain containing 1

60 Gene Product Result for
Synonyms: ECAT11 RP5-1155K23.3
UniProtKB ID: Q5T7N2, Q8NDA1, Q9NUV8, Q9NV78
Gene ID:
Mouse(381591) LINE-1 type transposase domain containing 1
Rat(685355) LINE-1 type transposase domain containing 1
dog(489563) LINE-1 type transposase domain containing 1
domestic cat(101098973) LINE-1 type transposase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0113 AQUA Peptide VFLSIEEF[R] human pricing
AQ0123 AQUA Peptide IASDSLSFLFI[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081202 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081202 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081202 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019341 MISSION® esiRNA esiRNA targeting human L1TD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019079 Rosetta Predictions human pricing
XM_001063462 Rosetta Predictions rat pricing
NM_001081202 Rosetta Predictions mouse pricing
XM_355549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054252 predicted 1822
2 SASI_Hs01_00054253 predicted 1874
3 SASI_Hs01_00054254 predicted 1819
4 SASI_Hs01_00054256 predicted 1873
5 SASI_Hs01_00054257 predicted 1818
6 SASI_Hs01_00054255 predicted 1820
7 SASI_Hs01_00054258 predicted 1822
8 SASI_Hs01_00054260 predicted 1693
9 SASI_Hs02_00352676 predicted 596
10 SASI_Hs02_00352677 predicted 1986
11 SASI_Hs01_00054259 predicted 2857
12 SASI_Hs01_00054261 predicted 1980
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307226 predicted 2275
2 SASI_Rn02_00307227 predicted 2381
3 SASI_Rn02_00307228 predicted 2405
4 SASI_Rn02_00307229 predicted 2522
5 SASI_Rn02_00307230 predicted 2392
6 SASI_Rn02_00307231 predicted 2392
7 SASI_Rn02_00307232 predicted 2458
8 SASI_Rn02_00307233 predicted 2342
9 SASI_Rn02_00307234 predicted 2346
10 SASI_Rn02_00307235 predicted 2356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296191 predicted 2420
2 SASI_Mm02_00296192 predicted 2185
3 SASI_Mm02_00296193 predicted 1069
4 SASI_Mm02_00296194 predicted 412
5 SASI_Mm02_00296195 predicted 1117
6 SASI_Mm02_00296196 predicted 725
7 SASI_Mm02_00296197 predicted 554
8 SASI_Mm02_00296198 predicted 2211
9 SASI_Mm02_00296199 predicted 593
10 SASI_Mm02_00296200 predicted 1924
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248359 predicted 2433
2 SASI_Mm01_00248360 predicted 2191
3 SASI_Mm01_00248361 predicted 1075
4 SASI_Mm01_00248362 predicted 427
5 SASI_Mm01_00248363 predicted 1123
6 SASI_Mm01_00248364 predicted 731
7 SASI_Mm01_00248365 predicted 557
8 SASI_Mm01_00248366 predicted 2216
9 SASI_Mm01_00248367 predicted 599
10 SASI_Mm01_00248368 predicted 1930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019079
L1TD1 MISSION shRNA Bacterial Glycerol Stock
LINE-1 type transposase domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019079.4-2551s21c1
Sequence:CCGGGCTTGTCGAGTACCTAGTAAACTCGAGTTTACTAGGTACTCGACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019079.4-759s21c1
Sequence:CCGGATTAGACAACACTAACGAATACTCGAGTATTCGTTAGTGTTGTCTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-2531s1c1
Sequence:CCGGCCTAGACACATCTTGGTGAAACTCGAGTTTCACCAAGATGTGTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-2669s1c1
Sequence:CCGGGCTAGAAGTAAATGGAGCAATCTCGAGATTGCTCCATTTACTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-396s1c1
Sequence:CCGGGCAAGGACGTATCAGCAATTACTCGAGTAATTGCTGATACGTCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-745s1c1
Sequence:CCGGCCAGGGTGAATCACGAAGTTACTCGAGTAACTTCGTGATTCACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-1719s1c1
Sequence:CCGGGCTCTGAAACAGGAAAGGTAACTCGAGTTACCTTTCCTGTTTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019079
L1TD1 MISSION shRNA shRNA Plasmid DNA
LINE-1 type transposase domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019079.4-2551s21c1
Sequence:CCGGGCTTGTCGAGTACCTAGTAAACTCGAGTTTACTAGGTACTCGACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019079.4-759s21c1
Sequence:CCGGATTAGACAACACTAACGAATACTCGAGTATTCGTTAGTGTTGTCTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-2531s1c1
Sequence:CCGGCCTAGACACATCTTGGTGAAACTCGAGTTTCACCAAGATGTGTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-2669s1c1
Sequence:CCGGGCTAGAAGTAAATGGAGCAATCTCGAGATTGCTCCATTTACTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-396s1c1
Sequence:CCGGGCAAGGACGTATCAGCAATTACTCGAGTAATTGCTGATACGTCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-745s1c1
Sequence:CCGGCCAGGGTGAATCACGAAGTTACTCGAGTAACTTCGTGATTCACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-1719s1c1
Sequence:CCGGGCTCTGAAACAGGAAAGGTAACTCGAGTTACCTTTCCTGTTTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019079
L1TD1 MISSION shRNA Lentiviral Transduction Particles
LINE-1 type transposase domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019079.4-2551s21c1
Sequence:CCGGGCTTGTCGAGTACCTAGTAAACTCGAGTTTACTAGGTACTCGACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019079.4-759s21c1
Sequence:CCGGATTAGACAACACTAACGAATACTCGAGTATTCGTTAGTGTTGTCTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-2531s1c1
Sequence:CCGGCCTAGACACATCTTGGTGAAACTCGAGTTTCACCAAGATGTGTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-2669s1c1
Sequence:CCGGGCTAGAAGTAAATGGAGCAATCTCGAGATTGCTCCATTTACTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-396s1c1
Sequence:CCGGGCAAGGACGTATCAGCAATTACTCGAGTAATTGCTGATACGTCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-745s1c1
Sequence:CCGGCCAGGGTGAATCACGAAGTTACTCGAGTAACTTCGTGATTCACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019079.2-1719s1c1
Sequence:CCGGGCTCTGAAACAGGAAAGGTAACTCGAGTTACCTTTCCTGTTTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081202
L1TD1 MISSION shRNA Bacterial Glycerol Stock
LINE-1 type transposase domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-2360s21c1
Sequence:CCGGGACTTATCACCTGGTACTATACTCGAGTATAGTACCAGGTGATAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-2391s21c1
Sequence:CCGGGCCAGTGGTGTGGTATCATAACTCGAGTTATGATACCACACCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-1616s21c1
Sequence:CCGGATGCCGTGTCTAACCTTATATCTCGAGATATAAGGTTAGACACGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081202.1-2720s21c1
Sequence:CCGGGGTTGAGTTAGACAGCGTATGCTCGAGCATACGCTGTCTAACTCAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-1085s21c1
Sequence:CCGGCTTCGGGAAAGATTGGGTAAACTCGAGTTTACCCAATCTTTCCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081202
L1TD1 MISSION shRNA shRNA Plasmid DNA
LINE-1 type transposase domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-2360s21c1
Sequence:CCGGGACTTATCACCTGGTACTATACTCGAGTATAGTACCAGGTGATAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-2391s21c1
Sequence:CCGGGCCAGTGGTGTGGTATCATAACTCGAGTTATGATACCACACCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-1616s21c1
Sequence:CCGGATGCCGTGTCTAACCTTATATCTCGAGATATAAGGTTAGACACGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081202.1-2720s21c1
Sequence:CCGGGGTTGAGTTAGACAGCGTATGCTCGAGCATACGCTGTCTAACTCAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-1085s21c1
Sequence:CCGGCTTCGGGAAAGATTGGGTAAACTCGAGTTTACCCAATCTTTCCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081202
L1TD1 MISSION shRNA Lentiviral Transduction Particles
LINE-1 type transposase domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-2360s21c1
Sequence:CCGGGACTTATCACCTGGTACTATACTCGAGTATAGTACCAGGTGATAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-2391s21c1
Sequence:CCGGGCCAGTGGTGTGGTATCATAACTCGAGTTATGATACCACACCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-1616s21c1
Sequence:CCGGATGCCGTGTCTAACCTTATATCTCGAGATATAAGGTTAGACACGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081202.1-2720s21c1
Sequence:CCGGGGTTGAGTTAGACAGCGTATGCTCGAGCATACGCTGTCTAACTCAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081202.1-1085s21c1
Sequence:CCGGCTTCGGGAAAGATTGGGTAAACTCGAGTTTACCCAATCTTTCCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)