EMAIL THIS PAGE TO A FRIEND

L2HGDH

L-2-hydroxyglutarate dehydrogenase

115 Gene Product Result for
Synonyms: C14orf160
UniProtKB ID: Q9H9P8, Q9BRR1
Gene ID:
Human(79944) Summary: This gene encodes L-2-hydroxyglutarate dehydrogenase, a FAD-dependent enzyme that oxidizes L-2-hydroxyglutarate to alpha-ketoglutarate in a variety of mammalian tissues. Mutations in this gene cause L-2-hydroxyglutaric aciduria, a rare autosomal recessive neurometabolic disorder resulting in moderate to severe mental retardation. [provided by RefSeq, Jul 2008]
Mouse(217666) L-2-hydroxyglutarate dehydrogenase
Rat(314196) L-2-hydroxyglutarate dehydrogenase
sheep(101121015) L-2-hydroxyglutarate dehydrogenase
Domestic Rabbit(100350193) L-2-hydroxyglutarate dehydrogenase
domestic guinea pig(100726948) L-2-hydroxyglutarate dehydrogenase
naked mole-rat(101702109) L-2-hydroxyglutarate dehydrogenase
Zebrafish(566872) L-2-hydroxyglutarate dehydrogenase
domestic cat(101094353) L-2-hydroxyglutarate dehydrogenase
cow(514230) L-2-hydroxyglutarate dehydrogenase
dog(480316) L-2-hydroxyglutarate dehydrogenase
chicken(423573) L-2-hydroxyglutarate dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024884 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024884 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024884 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024884 Rosetta Predictions human pricing
NM_001108028 Rosetta Predictions rat pricing
NM_145443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024884 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096354 predicted 838
2 SASI_Hs01_00096355 predicted 530
3 SASI_Hs01_00096356 predicted 432
4 SASI_Hs01_00096357 predicted 777
5 SASI_Hs01_00096359 predicted 637
6 SASI_Hs01_00096360 predicted 517
7 SASI_Hs01_00096361 predicted 406
8 SASI_Hs01_00096362 predicted 1136
9 SASI_Hs01_00096363 predicted 852
10 SASI_Hs02_00357477 predicted 291
11 SASI_Hs01_00096358 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234655 predicted 1110
2 SASI_Rn02_00234656 predicted 1151
3 SASI_Rn02_00234657 predicted 305
4 SASI_Rn02_00234658 predicted 1293
5 SASI_Rn02_00234659 predicted 1001
6 SASI_Rn02_00234660 predicted 1257
7 SASI_Rn02_00234661 predicted 564
8 SASI_Rn02_00234662 predicted 1361
9 SASI_Rn02_00234663 predicted 835
10 SASI_Rn02_00234664 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155255 predicted 1033
2 SASI_Mm01_00155257 predicted 461
3 SASI_Mm02_00340830 predicted 304
4 SASI_Mm01_00155258 predicted 831
5 SASI_Mm01_00155259 predicted 715
6 SASI_Mm02_00340831 predicted 1012
7 SASI_Mm01_00155261 predicted 794
8 SASI_Mm01_00155262 predicted 345
9 SASI_Mm02_00340832 predicted 225
10 SASI_Mm02_00340833 predicted 684
11 SASI_Mm01_00155253 predicted 1008
12 SASI_Mm01_00155254 predicted 1163
13 SASI_Mm01_00155256 predicted 1363
14 SASI_Mm01_00155260 predicted 1258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024884
VALIDATED
L2HGDH MISSION shRNA Bacterial Glycerol Stock
L-2-hydroxyglutarate dehydrogenase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-894s21c1
Sequence:CCGGGCACTCCTGATCCTCGAATTGCTCGAGCAATTCGAGGATCAGGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-858s21c1
Sequence:CCGGGACTTTACTCAGACCGTATTTCTCGAGAAATACGGTCTGAGTAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-773s21c1
Sequence:CCGGAGTATAGATGGAATGCAATATCTCGAGATATTGCATTCCATCTATACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-519s21c1
Sequence:CCGGCCAGACTTCAGGCCCTATATGCTCGAGCATATAGGGCCTGAAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-577s21c1
Sequence:CCGGGATCCAGCAGGAGGATATAAACTCGAGTTTATATCCTCCTGCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024884.2-1488s21c1
Sequence:CCGGGGTATGCACTGTAATCTTCATCTCGAGATGAAGATTACAGTGCATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1113s1c1
Sequence:CCGGCCACAGATGTTATGGATATAACTCGAGTTATATCCATAACATCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024884.1-674s1c1
Sequence:CCGGGCTTTGTCATTTGCCCAGGATCTCGAGATCCTGGGCAAATGACAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024884.1-360s1c1
Sequence:CCGGGTGGTGTCATACATAGTGGAACTCGAGTTCCACTATGTATGACACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1217s1c1
Sequence:CCGGGCAACAGTGAAGTATCTTCAACTCGAGTTGAAGATACTTCACTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1370s1c1
Sequence:CCGGCGCATTCTTCATGTGAGAAATCTCGAGATTTCTCACATGAAGAATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024884
VALIDATED
L2HGDH MISSION shRNA shRNA Plasmid DNA
L-2-hydroxyglutarate dehydrogenase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-894s21c1
Sequence:CCGGGCACTCCTGATCCTCGAATTGCTCGAGCAATTCGAGGATCAGGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-858s21c1
Sequence:CCGGGACTTTACTCAGACCGTATTTCTCGAGAAATACGGTCTGAGTAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-773s21c1
Sequence:CCGGAGTATAGATGGAATGCAATATCTCGAGATATTGCATTCCATCTATACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-519s21c1
Sequence:CCGGCCAGACTTCAGGCCCTATATGCTCGAGCATATAGGGCCTGAAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-577s21c1
Sequence:CCGGGATCCAGCAGGAGGATATAAACTCGAGTTTATATCCTCCTGCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024884.2-1488s21c1
Sequence:CCGGGGTATGCACTGTAATCTTCATCTCGAGATGAAGATTACAGTGCATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1113s1c1
Sequence:CCGGCCACAGATGTTATGGATATAACTCGAGTTATATCCATAACATCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024884.1-674s1c1
Sequence:CCGGGCTTTGTCATTTGCCCAGGATCTCGAGATCCTGGGCAAATGACAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024884.1-360s1c1
Sequence:CCGGGTGGTGTCATACATAGTGGAACTCGAGTTCCACTATGTATGACACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1217s1c1
Sequence:CCGGGCAACAGTGAAGTATCTTCAACTCGAGTTGAAGATACTTCACTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1370s1c1
Sequence:CCGGCGCATTCTTCATGTGAGAAATCTCGAGATTTCTCACATGAAGAATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024884
VALIDATED
L2HGDH MISSION shRNA Lentiviral Transduction Particles
L-2-hydroxyglutarate dehydrogenase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-894s21c1
Sequence:CCGGGCACTCCTGATCCTCGAATTGCTCGAGCAATTCGAGGATCAGGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-858s21c1
Sequence:CCGGGACTTTACTCAGACCGTATTTCTCGAGAAATACGGTCTGAGTAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-773s21c1
Sequence:CCGGAGTATAGATGGAATGCAATATCTCGAGATATTGCATTCCATCTATACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-519s21c1
Sequence:CCGGCCAGACTTCAGGCCCTATATGCTCGAGCATATAGGGCCTGAAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024884.2-577s21c1
Sequence:CCGGGATCCAGCAGGAGGATATAAACTCGAGTTTATATCCTCCTGCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024884.2-1488s21c1
Sequence:CCGGGGTATGCACTGTAATCTTCATCTCGAGATGAAGATTACAGTGCATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1113s1c1
Sequence:CCGGCCACAGATGTTATGGATATAACTCGAGTTATATCCATAACATCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024884.1-674s1c1
Sequence:CCGGGCTTTGTCATTTGCCCAGGATCTCGAGATCCTGGGCAAATGACAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024884.1-360s1c1
Sequence:CCGGGTGGTGTCATACATAGTGGAACTCGAGTTCCACTATGTATGACACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1217s1c1
Sequence:CCGGGCAACAGTGAAGTATCTTCAACTCGAGTTGAAGATACTTCACTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024884.1-1370s1c1
Sequence:CCGGCGCATTCTTCATGTGAGAAATCTCGAGATTTCTCACATGAAGAATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145443
VALIDATED
L2HGDH MISSION shRNA Bacterial Glycerol Stock
L-2-hydroxyglutarate dehydrogenase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-338s21c1
Sequence:CCGGCCAGAATCTCTGAAGGCTAAACTCGAGTTTAGCCTTCAGAGATTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-1114s21c1
Sequence:CCGGGCATTTCTCTTATGGAGTTAACTCGAGTTAACTCCATAAGAGAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-1703s21c1
Sequence:CCGGTGCTTGGGAAGACAACATAAACTCGAGTTTATGTTGTCTTCCCAAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145443.1-309s21c1
Sequence:CCGGGTGTCATACACAGTGGTATTTCTCGAGAAATACCACTGTGTATGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145443.1-1259s21c1
Sequence:CCGGGATGGAAATCTGGTAGAGGATCTCGAGATCCTCTACCAGATTTCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1114s1c1
Sequence:CCGGGCATTTCTCTTATGGAGTTAACTCGAGTTAACTCCATAAGAGAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1259s1c1
Sequence:CCGGGATGGAAATCTGGTAGAGGATCTCGAGATCCTCTACCAGATTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-2910s1c1
Sequence:CCGGGCGTCATAGTAAGGTTGTGTTCTCGAGAACACAACCTTACTATGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1363s1c1
Sequence:CCGGCCTGGCAATTTCTAGAATGATCTCGAGATCATTCTAGAAATTGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145443
VALIDATED
L2HGDH MISSION shRNA shRNA Plasmid DNA
L-2-hydroxyglutarate dehydrogenase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-338s21c1
Sequence:CCGGCCAGAATCTCTGAAGGCTAAACTCGAGTTTAGCCTTCAGAGATTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-1114s21c1
Sequence:CCGGGCATTTCTCTTATGGAGTTAACTCGAGTTAACTCCATAAGAGAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-1703s21c1
Sequence:CCGGTGCTTGGGAAGACAACATAAACTCGAGTTTATGTTGTCTTCCCAAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145443.1-309s21c1
Sequence:CCGGGTGTCATACACAGTGGTATTTCTCGAGAAATACCACTGTGTATGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145443.1-1259s21c1
Sequence:CCGGGATGGAAATCTGGTAGAGGATCTCGAGATCCTCTACCAGATTTCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1114s1c1
Sequence:CCGGGCATTTCTCTTATGGAGTTAACTCGAGTTAACTCCATAAGAGAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1259s1c1
Sequence:CCGGGATGGAAATCTGGTAGAGGATCTCGAGATCCTCTACCAGATTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-2910s1c1
Sequence:CCGGGCGTCATAGTAAGGTTGTGTTCTCGAGAACACAACCTTACTATGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1363s1c1
Sequence:CCGGCCTGGCAATTTCTAGAATGATCTCGAGATCATTCTAGAAATTGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145443
VALIDATED
L2HGDH MISSION shRNA Lentiviral Transduction Particles
L-2-hydroxyglutarate dehydrogenase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-338s21c1
Sequence:CCGGCCAGAATCTCTGAAGGCTAAACTCGAGTTTAGCCTTCAGAGATTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-1114s21c1
Sequence:CCGGGCATTTCTCTTATGGAGTTAACTCGAGTTAACTCCATAAGAGAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322402    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145443.1-1703s21c1
Sequence:CCGGTGCTTGGGAAGACAACATAAACTCGAGTTTATGTTGTCTTCCCAAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145443.1-309s21c1
Sequence:CCGGGTGTCATACACAGTGGTATTTCTCGAGAAATACCACTGTGTATGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145443.1-1259s21c1
Sequence:CCGGGATGGAAATCTGGTAGAGGATCTCGAGATCCTCTACCAGATTTCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1114s1c1
Sequence:CCGGGCATTTCTCTTATGGAGTTAACTCGAGTTAACTCCATAAGAGAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1259s1c1
Sequence:CCGGGATGGAAATCTGGTAGAGGATCTCGAGATCCTCTACCAGATTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173393    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-2910s1c1
Sequence:CCGGGCGTCATAGTAAGGTTGTGTTCTCGAGAACACAACCTTACTATGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145443.1-1363s1c1
Sequence:CCGGCCTGGCAATTTCTAGAATGATCTCGAGATCATTCTAGAAATTGCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)