EMAIL THIS PAGE TO A FRIEND

L3MBTL1

l(3)mbt-like 1 (Drosophila)

113 Gene Product Result for
Synonyms: H-L(3)MBT L3MBTL ZC2HC3 dJ138B7.3
Gene ID:
Human(26013) Summary: This gene represents a polycomb group gene. The encoded protein functions to regulate gene activity, likely via chromatin modification. The encoded protein may also be necessary for mitosis. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
Mouse(241764) l(3)mbt-like (Drosophila)
Rat(311613) l(3)mbt-like 1 (Drosophila)
sheep(101104848) l(3)mbt-like 1 (Drosophila)
domestic guinea pig(100718938) l(3)mbt-like 1 (Drosophila)
naked mole-rat(101718954) l(3)mbt-like 1 (Drosophila)
Zebrafish(100321295) l(3)mbt-like 1 (Drosophila)
cow(529298) l(3)mbt-like 1 (Drosophila)
domestic cat(101091436) l(3)mbt-like 1 (Drosophila)
dog(477231) l(3)mbt-like 1 (Drosophila)
chicken(419115) l(3)mbt-like 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015478 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081338 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081338 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081338 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144471 MISSION® esiRNA esiRNA human L3MBTL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015478 Rosetta Predictions human pricing
NM_032107 Rosetta Predictions human pricing
XM_001070026 Rosetta Predictions rat pricing
XM_230849 Rosetta Predictions rat pricing
NM_001081338 Rosetta Predictions mouse pricing
XM_895109 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347921 predicted 2000
2 SASI_Hs01_00012686 predicted 1381
3 SASI_Hs01_00012687 predicted 852
4 SASI_Hs01_00012688 predicted 1980
5 SASI_Hs01_00012689 predicted 870
6 SASI_Hs01_00012690 predicted 1561
7 SASI_Hs01_00012692 predicted 913
8 SASI_Hs01_00012693 predicted 589
9 SASI_Hs02_00347922 predicted 1566
10 SASI_Hs02_00347923 predicted 732
11 SASI_Hs01_00012684 predicted 805
12 SASI_Hs01_00012685 predicted 1733
13 SASI_Hs01_00012691 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359296 predicted 2001
2 SASI_Hs01_00187248 predicted 1382
3 SASI_Hs01_00187249 predicted 846
4 SASI_Hs01_00187250 predicted 1975
5 SASI_Hs01_00187251 predicted 873
6 SASI_Hs01_00187252 predicted 1560
7 SASI_Hs01_00187254 predicted 911
8 SASI_Hs01_00187255 predicted 591
9 SASI_Hs02_00359297 predicted 1571
10 SASI_Hs02_00359298 predicted 741
11 SASI_Hs01_00187246 predicted 801
12 SASI_Hs01_00187247 predicted 1729
13 SASI_Hs01_00187253 predicted 1798
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00330160 predicted 1795
2 SASI_Rn02_00330161 predicted 2057
3 SASI_Rn02_00330162 predicted 817
4 SASI_Rn02_00330163 predicted 594
5 SASI_Rn02_00330164 predicted 499
6 SASI_Rn02_00330165 predicted 623
7 SASI_Rn02_00330166 predicted 257
8 SASI_Rn02_00330167 predicted 1824
9 SASI_Rn02_00330168 predicted 1982
10 SASI_Rn02_00330169 predicted 1998
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230849 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386512 predicted 488
2 SASI_Rn02_00386513 predicted 1071
3 SASI_Rn02_00386514 predicted 517
4 SASI_Rn02_00386515 predicted 818
5 SASI_Rn02_00386516 predicted 595
6 SASI_Rn02_00386517 predicted 732
7 SASI_Rn02_00386518 predicted 593
8 SASI_Rn02_00386519 predicted 499
9 SASI_Rn02_00386520 predicted 623
10 SASI_Rn02_00386521 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081338 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297431 predicted 622
2 SASI_Mm02_00297432 predicted 2087
3 SASI_Mm02_00297433 predicted 2272
4 SASI_Mm02_00297434 predicted 370
5 SASI_Mm02_00297435 predicted 270
6 SASI_Mm02_00297436 predicted 492
7 SASI_Mm02_00297437 predicted 1776
8 SASI_Mm02_00297438 predicted 920
9 SASI_Mm02_00297439 predicted 2158
10 SASI_Mm02_00297440 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895109 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00277929 predicted 1674
2 SASI_Mm01_00277930 predicted 2098
3 SASI_Mm01_00277931 predicted 1591
4 SASI_Mm01_00277932 predicted 2435
5 SASI_Mm01_00277933 predicted 2276
6 SASI_Mm01_00277934 predicted 1423
7 SASI_Mm01_00277935 predicted 1786
8 SASI_Mm01_00277936 predicted 1859
9 SASI_Mm01_00277937 predicted 2324
10 SASI_Mm01_00277938 predicted 1742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015478
VALIDATED
L3MBTL1 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-917s1c1
Sequence:CCGGGCCTGCACTTTGATGGGTATTCTCGAGAATACCCATCAAAGTGCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-1975s1c1
Sequence:CCGGCCTCCGAAGTATCGAAAGATTCTCGAGAATCTTTCGATACTTCGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-2380s1c1
Sequence:CCGGCCCACTCATTTGCTTGCCAAACTCGAGTTTGGCAAGCAAATGAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015478.4-799s1c1
Sequence:CCGGGCAGTCACTCACAACAAGAATCTCGAGATTCTTGTTGTGAGTGACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-1565s1c1
Sequence:CCGGGCTGGAGTCATGGCTATGATTCTCGAGAATCATAGCCATGACTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-820s21c1
Sequence:CCGGGCAGTCACTCACAACAAGAATCTCGAGATTCTTGTTGTGAGTGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-2427s21c1
Sequence:CCGGCTTTGCCAGTGATAGTCAATACTCGAGTATTGACTATCACTGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-1562s21c1
Sequence:CCGGATCGGATAAAGATCCACTTTGCTCGAGCAAAGTGGATCTTTATCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-938s21c1
Sequence:CCGGGCCTGCACTTTGATGGGTATTCTCGAGAATACCCATCAAAGTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015478.5-2761s21c1
Sequence:CCGGTACCAGAACGTCTAGTATAATCTCGAGATTATACTAGACGTTCTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015478
VALIDATED
L3MBTL1 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-917s1c1
Sequence:CCGGGCCTGCACTTTGATGGGTATTCTCGAGAATACCCATCAAAGTGCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-1975s1c1
Sequence:CCGGCCTCCGAAGTATCGAAAGATTCTCGAGAATCTTTCGATACTTCGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-2380s1c1
Sequence:CCGGCCCACTCATTTGCTTGCCAAACTCGAGTTTGGCAAGCAAATGAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015478.4-799s1c1
Sequence:CCGGGCAGTCACTCACAACAAGAATCTCGAGATTCTTGTTGTGAGTGACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-1565s1c1
Sequence:CCGGGCTGGAGTCATGGCTATGATTCTCGAGAATCATAGCCATGACTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-820s21c1
Sequence:CCGGGCAGTCACTCACAACAAGAATCTCGAGATTCTTGTTGTGAGTGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-2427s21c1
Sequence:CCGGCTTTGCCAGTGATAGTCAATACTCGAGTATTGACTATCACTGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-1562s21c1
Sequence:CCGGATCGGATAAAGATCCACTTTGCTCGAGCAAAGTGGATCTTTATCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-938s21c1
Sequence:CCGGGCCTGCACTTTGATGGGTATTCTCGAGAATACCCATCAAAGTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015478.5-2761s21c1
Sequence:CCGGTACCAGAACGTCTAGTATAATCTCGAGATTATACTAGACGTTCTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015478
VALIDATED
L3MBTL1 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-917s1c1
Sequence:CCGGGCCTGCACTTTGATGGGTATTCTCGAGAATACCCATCAAAGTGCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-1975s1c1
Sequence:CCGGCCTCCGAAGTATCGAAAGATTCTCGAGAATCTTTCGATACTTCGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-2380s1c1
Sequence:CCGGCCCACTCATTTGCTTGCCAAACTCGAGTTTGGCAAGCAAATGAGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015478.4-799s1c1
Sequence:CCGGGCAGTCACTCACAACAAGAATCTCGAGATTCTTGTTGTGAGTGACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015478.4-1565s1c1
Sequence:CCGGGCTGGAGTCATGGCTATGATTCTCGAGAATCATAGCCATGACTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-820s21c1
Sequence:CCGGGCAGTCACTCACAACAAGAATCTCGAGATTCTTGTTGTGAGTGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-2427s21c1
Sequence:CCGGCTTTGCCAGTGATAGTCAATACTCGAGTATTGACTATCACTGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-1562s21c1
Sequence:CCGGATCGGATAAAGATCCACTTTGCTCGAGCAAAGTGGATCTTTATCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015478.5-938s21c1
Sequence:CCGGGCCTGCACTTTGATGGGTATTCTCGAGAATACCCATCAAAGTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329974    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015478.5-2761s21c1
Sequence:CCGGTACCAGAACGTCTAGTATAATCTCGAGATTATACTAGACGTTCTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081338
L3MBTL1 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-620s21c1
Sequence:CCGGACGCGCCACTGAACATGATAGCTCGAGCTATCATGTTCAGTGGCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2094s21c1
Sequence:CCGGCCACACAAAGACCTCCAAATACTCGAGTATTTGGAGGTCTTTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-1893s21c1
Sequence:CCGGTGTGGAGGATCATCGGATAAACTCGAGTTTATCCGATGATCCTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-1925s21c1
Sequence:CCGGATGGCTGGAGTCACAATTATGCTCGAGCATAATTGTGACTCCAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-362s21c1
Sequence:CCGGTGCCTACAACCGCCTTCATTACTCGAGTAATGAAGGCGGTTGTAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-595s21c1
Sequence:CCGGGGCATGCGGTTCCGGATAAATCTCGAGATTTATCCGGAACCGCATGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2274s21c1
Sequence:GTACCGGGAAGAAGAACCCGTCTAATTTCTCGAGAAATTAGACGGGTTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-487s21c1
Sequence:CCGGGAACCCGTAACAGCTACTATTCTCGAGAATAGTAGCTGTTACGGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2339s21c1
Sequence:CCGGCTCCAAAGTATCGCAAGATTCCTCGAGGAATCTTGCGATACTTTGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-725s21c1
Sequence:CCGGACCAGGACCGTCAAGATATAACTCGAGTTATATCTTGACGGTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081338
L3MBTL1 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-620s21c1
Sequence:CCGGACGCGCCACTGAACATGATAGCTCGAGCTATCATGTTCAGTGGCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2094s21c1
Sequence:CCGGCCACACAAAGACCTCCAAATACTCGAGTATTTGGAGGTCTTTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-1893s21c1
Sequence:CCGGTGTGGAGGATCATCGGATAAACTCGAGTTTATCCGATGATCCTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-1925s21c1
Sequence:CCGGATGGCTGGAGTCACAATTATGCTCGAGCATAATTGTGACTCCAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-362s21c1
Sequence:CCGGTGCCTACAACCGCCTTCATTACTCGAGTAATGAAGGCGGTTGTAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-595s21c1
Sequence:CCGGGGCATGCGGTTCCGGATAAATCTCGAGATTTATCCGGAACCGCATGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2274s21c1
Sequence:GTACCGGGAAGAAGAACCCGTCTAATTTCTCGAGAAATTAGACGGGTTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-487s21c1
Sequence:CCGGGAACCCGTAACAGCTACTATTCTCGAGAATAGTAGCTGTTACGGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2339s21c1
Sequence:CCGGCTCCAAAGTATCGCAAGATTCCTCGAGGAATCTTGCGATACTTTGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-725s21c1
Sequence:CCGGACCAGGACCGTCAAGATATAACTCGAGTTATATCTTGACGGTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081338
L3MBTL1 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-620s21c1
Sequence:CCGGACGCGCCACTGAACATGATAGCTCGAGCTATCATGTTCAGTGGCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2094s21c1
Sequence:CCGGCCACACAAAGACCTCCAAATACTCGAGTATTTGGAGGTCTTTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-1893s21c1
Sequence:CCGGTGTGGAGGATCATCGGATAAACTCGAGTTTATCCGATGATCCTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-1925s21c1
Sequence:CCGGATGGCTGGAGTCACAATTATGCTCGAGCATAATTGTGACTCCAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-362s21c1
Sequence:CCGGTGCCTACAACCGCCTTCATTACTCGAGTAATGAAGGCGGTTGTAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-595s21c1
Sequence:CCGGGGCATGCGGTTCCGGATAAATCTCGAGATTTATCCGGAACCGCATGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2274s21c1
Sequence:GTACCGGGAAGAAGAACCCGTCTAATTTCTCGAGAAATTAGACGGGTTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-487s21c1
Sequence:CCGGGAACCCGTAACAGCTACTATTCTCGAGAATAGTAGCTGTTACGGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-2339s21c1
Sequence:CCGGCTCCAAAGTATCGCAAGATTCCTCGAGGAATCTTGCGATACTTTGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081338.1-725s21c1
Sequence:CCGGACCAGGACCGTCAAGATATAACTCGAGTTATATCTTGACGGTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)