EMAIL THIS PAGE TO A FRIEND

L3MBTL2

l(3)mbt-like 2 (Drosophila)

61 Gene Product Result for
Synonyms: H-l(3)mbt-l L3MBT
UniProtKB ID: Q969R5, Q8TEN1, Q96SC4, Q9BQI2, Q9UGS4
Gene ID:
Mouse(214669) l(3)mbt-like 2 (Drosophila)
Rat(300320) l(3)mbt-like 2 (Drosophila)
Zebrafish(568473) l(3)mbt-like 2 (Drosophila)
dog(481235) l(3)mbt-like 2 (Drosophila)
chicken(417999) l(3)mbt-like 2 (Drosophila)
cow(513297) l(3)mbt-like 2 (Drosophila)
domestic cat(101089371) l(3)mbt-like 2 (Drosophila)
domestic guinea pig(100735100) l(3)mbt-like 2 (Drosophila)
naked mole-rat(101709598) l(3)mbt-like 2 (Drosophila)
sheep(101102895) l(3)mbt-like 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031488 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031488 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031488 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003689 Rosetta Predictions human pricing
NM_031488 Rosetta Predictions human pricing
NM_001033695 Rosetta Predictions rat pricing
NM_145993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143180 predicted 1266
2 SASI_Hs01_00143181 predicted 640
3 SASI_Hs01_00143182 predicted 1148
4 SASI_Hs01_00143183 predicted 430
5 SASI_Hs01_00143184 predicted 1382
6 SASI_Hs01_00143185 predicted 1554
7 SASI_Hs01_00143186 predicted 1631
8 SASI_Hs01_00143187 predicted 1565
9 SASI_Hs01_00143188 predicted 1641
10 SASI_Hs01_00143189 predicted 674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031488 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358925 predicted 1569
2 SASI_Hs01_00158704 predicted 1266
3 SASI_Hs01_00158705 predicted 634
4 SASI_Hs01_00158706 predicted 1143
5 SASI_Hs01_00158707 predicted 426
6 SASI_Hs01_00158708 predicted 1378
7 SASI_Hs01_00158709 predicted 1551
8 SASI_Hs01_00158710 predicted 1630
9 SASI_Hs01_00158711 predicted 1562
10 SASI_Hs01_00158712 predicted 1630
11 SASI_Hs01_00158713 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203715 predicted 229
2 SASI_Rn02_00203716 predicted 576
3 SASI_Rn02_00203717 predicted 1339
4 SASI_Rn02_00203718 predicted 1000
5 SASI_Rn02_00203719 predicted 779
6 SASI_Rn02_00203720 predicted 1325
7 SASI_Rn02_00203721 predicted 1105
8 SASI_Rn02_00203722 predicted 390
9 SASI_Rn02_00203723 predicted 1330
10 SASI_Rn02_00203724 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106829 predicted 437
2 SASI_Mm01_00106830 predicted 794
3 SASI_Mm01_00106831 predicted 794
4 SASI_Mm01_00106832 predicted 982
5 SASI_Mm01_00106834 predicted 1371
6 SASI_Mm01_00106835 predicted 269
7 SASI_Mm01_00106836 predicted 219
8 SASI_Mm02_00341508 predicted 1814
9 SASI_Mm02_00341509 predicted 1009
10 SASI_Mm02_00341510 predicted 1350
11 SASI_Mm01_00106827 predicted 2005
12 SASI_Mm01_00106828 predicted 1996
13 SASI_Mm01_00106833 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031488
VALIDATED
L3MBTL2 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 2 (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-1614s1c1
Sequence:CCGGCGAGACTCTTTAACATGGATTCTCGAGAATCCATGTTAAAGAGTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-416s1c1
Sequence:CCGGGCCAGTATCTTGGCTAGATTACTCGAGTAATCTAGCCAAGATACTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-1502s1c1
Sequence:CCGGGCCACCTTCTGTCAGAAGAATCTCGAGATTCTTCTGACAGAAGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031488.3-2060s1c1
Sequence:CCGGCGTGTGAAGGAAGAGCATCTACTCGAGTAGATGCTCTTCCTTCACACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031488.3-776s1c1
Sequence:CCGGCTTCGGTATGAAGGCTTTGAACTCGAGTTCAAAGCCTTCATACCGAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-144s21c1
Sequence:CCGGTGATAGTTTCCGGAGTTATAACTCGAGTTATAACTCCGGAAACTATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031488.4-2568s21c1
Sequence:CCGGTGCCTGAACGAGCCATGTAAACTCGAGTTTACATGGCTCGTTCAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-647s21c1
Sequence:CCGGTCAAGCACGTCCCACTCTATGCTCGAGCATAGAGTGGGACGTGCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031488.4-2266s21c1
Sequence:CCGGCTGATCCTCTCTGTGTAAATTCTCGAGAATTTACACAGAGAGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-2045s21c1
Sequence:CCGGCTGTTCCTGGCGAGATCATTGCTCGAGCAATGATCTCGCCAGGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-1616s21c1
Sequence:CCGGCCGCTCCATCGAGACTCTTTACTCGAGTAAAGAGTCTCGATGGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031488
VALIDATED
L3MBTL2 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 2 (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-1614s1c1
Sequence:CCGGCGAGACTCTTTAACATGGATTCTCGAGAATCCATGTTAAAGAGTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-416s1c1
Sequence:CCGGGCCAGTATCTTGGCTAGATTACTCGAGTAATCTAGCCAAGATACTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-1502s1c1
Sequence:CCGGGCCACCTTCTGTCAGAAGAATCTCGAGATTCTTCTGACAGAAGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031488.3-2060s1c1
Sequence:CCGGCGTGTGAAGGAAGAGCATCTACTCGAGTAGATGCTCTTCCTTCACACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031488.3-776s1c1
Sequence:CCGGCTTCGGTATGAAGGCTTTGAACTCGAGTTCAAAGCCTTCATACCGAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-144s21c1
Sequence:CCGGTGATAGTTTCCGGAGTTATAACTCGAGTTATAACTCCGGAAACTATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031488.4-2568s21c1
Sequence:CCGGTGCCTGAACGAGCCATGTAAACTCGAGTTTACATGGCTCGTTCAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-647s21c1
Sequence:CCGGTCAAGCACGTCCCACTCTATGCTCGAGCATAGAGTGGGACGTGCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031488.4-2266s21c1
Sequence:CCGGCTGATCCTCTCTGTGTAAATTCTCGAGAATTTACACAGAGAGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-2045s21c1
Sequence:CCGGCTGTTCCTGGCGAGATCATTGCTCGAGCAATGATCTCGCCAGGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-1616s21c1
Sequence:CCGGCCGCTCCATCGAGACTCTTTACTCGAGTAAAGAGTCTCGATGGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031488
VALIDATED
L3MBTL2 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 2 (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-1614s1c1
Sequence:CCGGCGAGACTCTTTAACATGGATTCTCGAGAATCCATGTTAAAGAGTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-416s1c1
Sequence:CCGGGCCAGTATCTTGGCTAGATTACTCGAGTAATCTAGCCAAGATACTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031488.3-1502s1c1
Sequence:CCGGGCCACCTTCTGTCAGAAGAATCTCGAGATTCTTCTGACAGAAGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031488.3-2060s1c1
Sequence:CCGGCGTGTGAAGGAAGAGCATCTACTCGAGTAGATGCTCTTCCTTCACACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_031488.3-776s1c1
Sequence:CCGGCTTCGGTATGAAGGCTTTGAACTCGAGTTCAAAGCCTTCATACCGAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-144s21c1
Sequence:CCGGTGATAGTTTCCGGAGTTATAACTCGAGTTATAACTCCGGAAACTATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031488.4-2568s21c1
Sequence:CCGGTGCCTGAACGAGCCATGTAAACTCGAGTTTACATGGCTCGTTCAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-647s21c1
Sequence:CCGGTCAAGCACGTCCCACTCTATGCTCGAGCATAGAGTGGGACGTGCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031488.4-2266s21c1
Sequence:CCGGCTGATCCTCTCTGTGTAAATTCTCGAGAATTTACACAGAGAGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-2045s21c1
Sequence:CCGGCTGTTCCTGGCGAGATCATTGCTCGAGCAATGATCTCGCCAGGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031488.4-1616s21c1
Sequence:CCGGCCGCTCCATCGAGACTCTTTACTCGAGTAAAGAGTCTCGATGGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145993
VALIDATED
L3MBTL2 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-3113s1c1
Sequence:CCGGCGCCAGTCAAGTCTTGTTCATCTCGAGATGAACAAGACTTGACTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-789s1c1
Sequence:CCGGCGGGTGCTGCTCCGATATGAACTCGAGTTCATATCGGAGCAGCACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-1931s1c1
Sequence:CCGGGAAGAAACAGTTTGGGAAGAACTCGAGTTCTTCCCAAACTGTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-1424s1c1
Sequence:CCGGGCTCTTGGATGGTTACCTGATCTCGAGATCAGGTAACCATCCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-798s1c1
Sequence:CCGGCTCCGATATGAAGGCTTTGAACTCGAGTTCAAAGCCTTCATATCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145993.4-1345s21c1
Sequence:CCGGGGTTCGAGGAAGGAATGAAACCTCGAGGTTTCATTCCTTCCTCGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145993.4-916s21c1
Sequence:CCGGGGACCATCCATGCCAAGTTTACTCGAGTAAACTTGGCATGGATGGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145993.4-2541s21c1
Sequence:CCGGCCTTGACCTCAGGGATAACAACTCGAGTTGTTATCCCTGAGGTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145993.4-2362s21c1
Sequence:CCGGCAAGTGGTAGAAGTAAGGTTACTCGAGTAACCTTACTTCTACCACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145993
VALIDATED
L3MBTL2 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-3113s1c1
Sequence:CCGGCGCCAGTCAAGTCTTGTTCATCTCGAGATGAACAAGACTTGACTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-789s1c1
Sequence:CCGGCGGGTGCTGCTCCGATATGAACTCGAGTTCATATCGGAGCAGCACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-1931s1c1
Sequence:CCGGGAAGAAACAGTTTGGGAAGAACTCGAGTTCTTCCCAAACTGTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-1424s1c1
Sequence:CCGGGCTCTTGGATGGTTACCTGATCTCGAGATCAGGTAACCATCCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-798s1c1
Sequence:CCGGCTCCGATATGAAGGCTTTGAACTCGAGTTCAAAGCCTTCATATCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145993.4-1345s21c1
Sequence:CCGGGGTTCGAGGAAGGAATGAAACCTCGAGGTTTCATTCCTTCCTCGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145993.4-916s21c1
Sequence:CCGGGGACCATCCATGCCAAGTTTACTCGAGTAAACTTGGCATGGATGGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145993.4-2541s21c1
Sequence:CCGGCCTTGACCTCAGGGATAACAACTCGAGTTGTTATCCCTGAGGTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145993.4-2362s21c1
Sequence:CCGGCAAGTGGTAGAAGTAAGGTTACTCGAGTAACCTTACTTCTACCACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145993
VALIDATED
L3MBTL2 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-3113s1c1
Sequence:CCGGCGCCAGTCAAGTCTTGTTCATCTCGAGATGAACAAGACTTGACTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-789s1c1
Sequence:CCGGCGGGTGCTGCTCCGATATGAACTCGAGTTCATATCGGAGCAGCACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-1931s1c1
Sequence:CCGGGAAGAAACAGTTTGGGAAGAACTCGAGTTCTTCCCAAACTGTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-1424s1c1
Sequence:CCGGGCTCTTGGATGGTTACCTGATCTCGAGATCAGGTAACCATCCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145993.2-798s1c1
Sequence:CCGGCTCCGATATGAAGGCTTTGAACTCGAGTTCAAAGCCTTCATATCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145993.4-1345s21c1
Sequence:CCGGGGTTCGAGGAAGGAATGAAACCTCGAGGTTTCATTCCTTCCTCGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145993.4-916s21c1
Sequence:CCGGGGACCATCCATGCCAAGTTTACTCGAGTAAACTTGGCATGGATGGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145993.4-2541s21c1
Sequence:CCGGCCTTGACCTCAGGGATAACAACTCGAGTTGTTATCCCTGAGGTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145993.4-2362s21c1
Sequence:CCGGCAAGTGGTAGAAGTAAGGTTACTCGAGTAACCTTACTTCTACCACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)