EMAIL THIS PAGE TO A FRIEND

L3MBTL3

l(3)mbt-like 3 (Drosophila)

190 Gene Product Result for
Synonyms: MBT-1 MBT1 RP11-73O6.1
UniProtKB ID: Q96JM7, Q4VXE1, Q5VUM9, Q6P9B5
Gene ID:
Mouse(237339) l(3)mbt-like 3 (Drosophila)
Rat(309550) l(3)mbt-like 3 (Drosophila)
sheep(101119314) l(3)mbt-like 3 (Drosophila)
Domestic Rabbit(100341438) l(3)mbt-like 3 (Drosophila)
domestic guinea pig(100713463) l(3)mbt-like 3 (Drosophila)
naked mole-rat(101697082) l(3)mbt-like 3 (Drosophila)
Zebrafish(403075) l(3)mbt-like 3 (Drosophila)
chicken(421705) l(3)mbt-like 3 (Drosophila)
domestic cat(101087839) l(3)mbt-like 3 (Drosophila)
cow(524334) l(3)mbt-like 3 (Drosophila)
Horse(100067448) l(3)mbt-like 3 (Drosophila)
dog(612721) l(3)mbt-like 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032438 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007102 Rosetta Predictions human pricing
NM_032438 Rosetta Predictions human pricing
NM_001107612 Rosetta Predictions rat pricing
NM_172787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122618 predicted 1123
2 SASI_Hs02_00305227 predicted 671
3 SASI_Hs01_00122620 predicted 952
4 SASI_Hs01_00122621 predicted 2319
5 SASI_Hs01_00122622 predicted 847
6 SASI_Hs01_00122624 predicted 1252
7 SASI_Hs01_00122625 predicted 972
8 SASI_Hs01_00122626 predicted 2465
9 SASI_Hs02_00305228 predicted 1317
10 SASI_Hs01_00122627 predicted 1339
11 SASI_Hs01_00122619 predicted 1848
12 SASI_Hs01_00122623 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237569 predicted 1193
2 SASI_Hs02_00359849 predicted 748
3 SASI_Hs01_00237571 predicted 1025
4 SASI_Hs01_00237572 predicted 2391
5 SASI_Hs01_00237573 predicted 928
6 SASI_Hs01_00237575 predicted 1328
7 SASI_Hs01_00237576 predicted 1041
8 SASI_Hs01_00237577 predicted 2540
9 SASI_Hs02_00359850 predicted 1390
10 SASI_Hs01_00237578 predicted 1417
11 SASI_Hs01_00237570 predicted 1923
12 SASI_Hs01_00237574 predicted 1410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230545 predicted 502
2 SASI_Rn02_00230546 predicted 463
3 SASI_Rn02_00230547 predicted 388
4 SASI_Rn02_00230548 predicted 873
5 SASI_Rn02_00230549 predicted 541
6 SASI_Rn02_00230550 predicted 618
7 SASI_Rn02_00230551 predicted 441
8 SASI_Rn02_00230552 predicted 932
9 SASI_Rn02_00230553 predicted 538
10 SASI_Rn02_00230554 predicted 857
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344684 predicted 2759
2 SASI_Mm01_00089317 predicted 843
3 SASI_Mm01_00089318 predicted 586
4 SASI_Mm01_00089319 predicted 1053
5 SASI_Mm01_00089320 predicted 1248
6 SASI_Mm01_00089321 predicted 1098
7 SASI_Mm01_00089322 predicted 2622
8 SASI_Mm01_00089323 predicted 459
9 SASI_Mm01_00089324 predicted 2615
10 SASI_Mm01_00089325 predicted 1336
11 SASI_Mm01_00089316 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032438
L3MBTL3 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 3 (Drosophila)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1667s21c1
Sequence:CCGGCACAGATGATCACCGGGTAAACTCGAGTTTACCCGGTGATCATCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032438.1-2946s21c1
Sequence:CCGGGTCGAAACCTGGCTAAGTTTACTCGAGTAAACTTAGCCAGGTTTCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1226s21c1
Sequence:CCGGAGCTGCTCCTAAGTCATTATTCTCGAGAATAATGACTTAGGAGCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032438.1-2568s21c1
Sequence:CCGGCAAAGCACAAGGACGGTTATACTCGAGTATAACCGTCCTTGTGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1461s21c1
Sequence:CCGGGAACATAGAAGAACCCTTATTCTCGAGAATAAGGGTTCTTCTATGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1364s21c1
Sequence:CCGGCAATCGTTTCCTGGTACATTTCTCGAGAAATGTACCAGGAAACGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1394s21c1
Sequence:CCGGGGATGAGAGCTATGACTATTGCTCGAGCAATAGTCATAGCTCTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1828s1c1
Sequence:CCGGCAGAACATGGTGGATGCTCAACTCGAGTTGAGCATCCACCATGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-603s1c1
Sequence:CCGGCGGCACATCAAAGATAAAGATCTCGAGATCTTTATCTTTGATGTGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-1993s1c1
Sequence:CCGGGTCCGTCATTTCCAAGAAATACTCGAGTATTTCTTGGAAATGACGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1347s1c1
Sequence:CCGGGTAACAGATATGGTGGACAATCTCGAGATTGTCCACCATATCTGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-1702s1c1
Sequence:CCGGGCTGGAACAATTGCTATGATTCTCGAGAATCATAGCAATTGTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032438.1-4010s1c1
Sequence:CCGGCCTTTGCATTTGCCAATTCAACTCGAGTTGAATTGGCAAATGCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-255s1c1
Sequence:CCGGCCAGGAAGTGACTTAAAGTTTCTCGAGAAACTTTAAGTCACTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1474s1c1
Sequence:CCGGCCCTTATTACTCCACCAGGTTCTCGAGAACCTGGTGGAGTAATAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032438
L3MBTL3 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 3 (Drosophila)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1667s21c1
Sequence:CCGGCACAGATGATCACCGGGTAAACTCGAGTTTACCCGGTGATCATCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032438.1-2946s21c1
Sequence:CCGGGTCGAAACCTGGCTAAGTTTACTCGAGTAAACTTAGCCAGGTTTCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1226s21c1
Sequence:CCGGAGCTGCTCCTAAGTCATTATTCTCGAGAATAATGACTTAGGAGCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032438.1-2568s21c1
Sequence:CCGGCAAAGCACAAGGACGGTTATACTCGAGTATAACCGTCCTTGTGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1461s21c1
Sequence:CCGGGAACATAGAAGAACCCTTATTCTCGAGAATAAGGGTTCTTCTATGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1364s21c1
Sequence:CCGGCAATCGTTTCCTGGTACATTTCTCGAGAAATGTACCAGGAAACGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1394s21c1
Sequence:CCGGGGATGAGAGCTATGACTATTGCTCGAGCAATAGTCATAGCTCTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1828s1c1
Sequence:CCGGCAGAACATGGTGGATGCTCAACTCGAGTTGAGCATCCACCATGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-603s1c1
Sequence:CCGGCGGCACATCAAAGATAAAGATCTCGAGATCTTTATCTTTGATGTGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-1993s1c1
Sequence:CCGGGTCCGTCATTTCCAAGAAATACTCGAGTATTTCTTGGAAATGACGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1347s1c1
Sequence:CCGGGTAACAGATATGGTGGACAATCTCGAGATTGTCCACCATATCTGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-1702s1c1
Sequence:CCGGGCTGGAACAATTGCTATGATTCTCGAGAATCATAGCAATTGTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032438.1-4010s1c1
Sequence:CCGGCCTTTGCATTTGCCAATTCAACTCGAGTTGAATTGGCAAATGCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-255s1c1
Sequence:CCGGCCAGGAAGTGACTTAAAGTTTCTCGAGAAACTTTAAGTCACTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1474s1c1
Sequence:CCGGCCCTTATTACTCCACCAGGTTCTCGAGAACCTGGTGGAGTAATAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032438
L3MBTL3 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 3 (Drosophila)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1667s21c1
Sequence:CCGGCACAGATGATCACCGGGTAAACTCGAGTTTACCCGGTGATCATCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436283    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032438.1-2946s21c1
Sequence:CCGGGTCGAAACCTGGCTAAGTTTACTCGAGTAAACTTAGCCAGGTTTCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1226s21c1
Sequence:CCGGAGCTGCTCCTAAGTCATTATTCTCGAGAATAATGACTTAGGAGCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424756    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032438.1-2568s21c1
Sequence:CCGGCAAAGCACAAGGACGGTTATACTCGAGTATAACCGTCCTTGTGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1461s21c1
Sequence:CCGGGAACATAGAAGAACCCTTATTCTCGAGAATAAGGGTTCTTCTATGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1364s21c1
Sequence:CCGGCAATCGTTTCCTGGTACATTTCTCGAGAAATGTACCAGGAAACGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032438.1-1394s21c1
Sequence:CCGGGGATGAGAGCTATGACTATTGCTCGAGCAATAGTCATAGCTCTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154351    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1828s1c1
Sequence:CCGGCAGAACATGGTGGATGCTCAACTCGAGTTGAGCATCCACCATGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-603s1c1
Sequence:CCGGCGGCACATCAAAGATAAAGATCTCGAGATCTTTATCTTTGATGTGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-1993s1c1
Sequence:CCGGGTCCGTCATTTCCAAGAAATACTCGAGTATTTCTTGGAAATGACGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1347s1c1
Sequence:CCGGGTAACAGATATGGTGGACAATCTCGAGATTGTCCACCATATCTGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-1702s1c1
Sequence:CCGGGCTGGAACAATTGCTATGATTCTCGAGAATCATAGCAATTGTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032438.1-4010s1c1
Sequence:CCGGCCTTTGCATTTGCCAATTCAACTCGAGTTGAATTGGCAAATGCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032438.1-255s1c1
Sequence:CCGGCCAGGAAGTGACTTAAAGTTTCTCGAGAAACTTTAAGTCACTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032438.1-1474s1c1
Sequence:CCGGCCCTTATTACTCCACCAGGTTCTCGAGAACCTGGTGGAGTAATAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172787
VALIDATED
L3MBTL3 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172787.1-2957s1c1
Sequence:CCGGCCGCTCACTGAGCTAAACTTACTCGAGTAAGTTTAGCTCAGTGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-2501s1c1
Sequence:CCGGCCCAGCTAGTAGAGTTTCCAACTCGAGTTGGAAACTCTACTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172787.1-2502s1c1
Sequence:CCGGCCAGCTAGTAGAGTTTCCAAACTCGAGTTTGGAAACTCTACTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-851s1c1
Sequence:CCGGGCACCAATCCTTCCCATATAACTCGAGTTATATGGGAAGGATTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-1410s1c1
Sequence:CCGGCCAGGCTATTCTCATGTGAAACTCGAGTTTCACATGAGAATAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172787
VALIDATED
L3MBTL3 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172787.1-2957s1c1
Sequence:CCGGCCGCTCACTGAGCTAAACTTACTCGAGTAAGTTTAGCTCAGTGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-2501s1c1
Sequence:CCGGCCCAGCTAGTAGAGTTTCCAACTCGAGTTGGAAACTCTACTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172787.1-2502s1c1
Sequence:CCGGCCAGCTAGTAGAGTTTCCAAACTCGAGTTTGGAAACTCTACTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-851s1c1
Sequence:CCGGGCACCAATCCTTCCCATATAACTCGAGTTATATGGGAAGGATTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-1410s1c1
Sequence:CCGGCCAGGCTATTCTCATGTGAAACTCGAGTTTCACATGAGAATAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172787
VALIDATED
L3MBTL3 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097624    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172787.1-2957s1c1
Sequence:CCGGCCGCTCACTGAGCTAAACTTACTCGAGTAAGTTTAGCTCAGTGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-2501s1c1
Sequence:CCGGCCCAGCTAGTAGAGTTTCCAACTCGAGTTGGAAACTCTACTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172787.1-2502s1c1
Sequence:CCGGCCAGCTAGTAGAGTTTCCAAACTCGAGTTTGGAAACTCTACTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-851s1c1
Sequence:CCGGGCACCAATCCTTCCCATATAACTCGAGTTATATGGGAAGGATTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172787.1-1410s1c1
Sequence:CCGGCCAGGCTATTCTCATGTGAAACTCGAGTTTCACATGAGAATAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)