EMAIL THIS PAGE TO A FRIEND

L3MBTL4

l(3)mbt-like 4 (Drosophila)

93 Gene Product Result for
Synonyms: HsT1031
UniProtKB ID: Q8NA19, A8MTL8, Q8IXS3
Gene ID:
Mouse(320858) l(3)mbt-like 4 (Drosophila)
chicken(419599) l(3)mbt-like 4 (Drosophila)
dog(490541) l(3)mbt-like 4 (Drosophila)
domestic cat(101083551) l(3)mbt-like 4 (Drosophila)
naked mole-rat(101705177) l(3)mbt-like 4 (Drosophila)
Domestic Rabbit(100358163) l(3)mbt-like 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173464 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177278 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177278 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177278 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173464 Rosetta Predictions human pricing
NM_177278 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092958 predicted 896
2 SASI_Hs01_00092960 predicted 520
3 SASI_Hs01_00092961 predicted 749
4 SASI_Hs01_00092963 predicted 1360
5 SASI_Hs01_00092964 predicted 896
6 SASI_Hs01_00092965 predicted 1091
7 SASI_Hs01_00092966 predicted 1375
8 SASI_Hs02_00368203 predicted 1449
9 SASI_Hs02_00368204 predicted 1619
10 SASI_Hs02_00368205 predicted 1574
11 SASI_Hs01_00092959 predicted 415
12 SASI_Hs01_00092962 predicted 498
13 SASI_Hs01_00092967 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177278 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347327 predicted 2423
2 SASI_Mm02_00347328 predicted 2322
3 SASI_Mm02_00347329 predicted 1360
4 SASI_Mm02_00347330 predicted 1658
5 SASI_Mm02_00347331 predicted 2298
6 SASI_Mm02_00347332 predicted 1856
7 SASI_Mm02_00347333 predicted 1023
8 SASI_Mm02_00347334 predicted 1118
9 SASI_Mm02_00347335 predicted 2426
10 SASI_Mm02_00347336 predicted 1570
11 SASI_Mm01_00105253 predicted 768
12 SASI_Mm01_00105254 predicted 1070
13 SASI_Mm01_00105255 predicted 986
14 SASI_Mm01_00105256 predicted 1322
15 SASI_Mm01_00105257 predicted 1146
16 SASI_Mm01_00105258 predicted 1048
17 SASI_Mm01_00105259 predicted 1162
18 SASI_Mm01_00105260 predicted 1256
19 SASI_Mm01_00105261 predicted 1050
20 SASI_Mm01_00105262 predicted 986
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173464
L3MBTL4 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 4 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173464.3-1368s21c1
Sequence:CCGGTATCCGTGGTCCACGTTATTCCTCGAGGAATAACGTGGACCACGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173464.3-648s21c1
Sequence:CCGGGCACATCCCTAAGGGTTATAGCTCGAGCTATAACCCTTAGGGATGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173464.3-2454s21c1
Sequence:CCGGGTTCATGAATACATCGTTAATCTCGAGATTAACGATGTATTCATGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1288s1c1
Sequence:CCGGGCGAACGAATGACCTGAAGATCTCGAGATCTTCAGGTCATTCGTTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1513s1c1
Sequence:CCGGCCTCTGTAGTTTGAACTTCAACTCGAGTTGAAGTTCAAACTACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1139s1c1
Sequence:CCGGGCTACGATTGTAGATGTTGATCTCGAGATCAACATCTACAATCGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000015978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1122s1c1
Sequence:CCGGCCAGGTTAATTCGTGTTGCTACTCGAGTAGCAACACGAATTAACCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173464
L3MBTL4 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 4 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173464.3-1368s21c1
Sequence:CCGGTATCCGTGGTCCACGTTATTCCTCGAGGAATAACGTGGACCACGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173464.3-648s21c1
Sequence:CCGGGCACATCCCTAAGGGTTATAGCTCGAGCTATAACCCTTAGGGATGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173464.3-2454s21c1
Sequence:CCGGGTTCATGAATACATCGTTAATCTCGAGATTAACGATGTATTCATGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1288s1c1
Sequence:CCGGGCGAACGAATGACCTGAAGATCTCGAGATCTTCAGGTCATTCGTTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1513s1c1
Sequence:CCGGCCTCTGTAGTTTGAACTTCAACTCGAGTTGAAGTTCAAACTACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1139s1c1
Sequence:CCGGGCTACGATTGTAGATGTTGATCTCGAGATCAACATCTACAATCGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1122s1c1
Sequence:CCGGCCAGGTTAATTCGTGTTGCTACTCGAGTAGCAACACGAATTAACCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173464
L3MBTL4 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 4 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173464.3-1368s21c1
Sequence:CCGGTATCCGTGGTCCACGTTATTCCTCGAGGAATAACGTGGACCACGGATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173464.3-648s21c1
Sequence:CCGGGCACATCCCTAAGGGTTATAGCTCGAGCTATAACCCTTAGGGATGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173464.3-2454s21c1
Sequence:CCGGGTTCATGAATACATCGTTAATCTCGAGATTAACGATGTATTCATGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1288s1c1
Sequence:CCGGGCGAACGAATGACCTGAAGATCTCGAGATCTTCAGGTCATTCGTTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1513s1c1
Sequence:CCGGCCTCTGTAGTTTGAACTTCAACTCGAGTTGAAGTTCAAACTACAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1139s1c1
Sequence:CCGGGCTACGATTGTAGATGTTGATCTCGAGATCAACATCTACAATCGTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000015978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173464.1-1122s1c1
Sequence:CCGGCCAGGTTAATTCGTGTTGCTACTCGAGTAGCAACACGAATTAACCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177278
L3MBTL4 MISSION shRNA Bacterial Glycerol Stock
l(3)mbt-like 4 (Drosophila)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000097705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177278.2-1155s1c1
Sequence:CCGGCCATGACAATGCCTTAGAGATCTCGAGATCTCTAAGGCATTGTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-660s1c1
Sequence:CCGGCCACACCTTCAAAGCGAGAATCTCGAGATTCTCGCTTTGAAGGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-743s1c1
Sequence:CCGGGCTGCACCAGTAGAACTGTTTCTCGAGAAACAGTTCTACTGGTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-1046s1c1
Sequence:CCGGGTACTTGTTATTCCAGCTTTACTCGAGTAAAGCTGGAATAACAAGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177278
L3MBTL4 MISSION shRNA shRNA Plasmid DNA
l(3)mbt-like 4 (Drosophila)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000097705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177278.2-1155s1c1
Sequence:CCGGCCATGACAATGCCTTAGAGATCTCGAGATCTCTAAGGCATTGTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-660s1c1
Sequence:CCGGCCACACCTTCAAAGCGAGAATCTCGAGATTCTCGCTTTGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-743s1c1
Sequence:CCGGGCTGCACCAGTAGAACTGTTTCTCGAGAAACAGTTCTACTGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-1046s1c1
Sequence:CCGGGTACTTGTTATTCCAGCTTTACTCGAGTAAAGCTGGAATAACAAGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177278
L3MBTL4 MISSION shRNA Lentiviral Transduction Particles
l(3)mbt-like 4 (Drosophila)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000097705    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177278.2-1155s1c1
Sequence:CCGGCCATGACAATGCCTTAGAGATCTCGAGATCTCTAAGGCATTGTCATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-660s1c1
Sequence:CCGGCCACACCTTCAAAGCGAGAATCTCGAGATTCTCGCTTTGAAGGTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-743s1c1
Sequence:CCGGGCTGCACCAGTAGAACTGTTTCTCGAGAAACAGTTCTACTGGTGCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177278.2-1046s1c1
Sequence:CCGGGTACTTGTTATTCCAGCTTTACTCGAGTAAAGCTGGAATAACAAGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)