EMAIL THIS PAGE TO A FRIEND

l7Rn6

24 Gene Product Result for
Gene ID:
Rat(293103) lethal, Chr 7, Rinchik 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026304 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026304 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026304 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU021231 MISSION® esiRNA targeting mouse L7rn6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013897 Rosetta Predictions rat pricing
NM_026304 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100441 predicted 426
2 SASI_Rn01_00100442 predicted 635
3 SASI_Rn01_00100443 predicted 436
4 SASI_Rn01_00100444 predicted 464
5 SASI_Rn01_00100445 predicted 871
6 SASI_Rn01_00100447 predicted 516
7 SASI_Rn01_00100448 predicted 751
8 SASI_Rn01_00100449 predicted 704
9 SASI_Rn02_00201176 predicted 522
10 SASI_Rn02_00201177 predicted 509
11 SASI_Rn01_00100446 predicted 726
12 SASI_Rn01_00100450 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026304 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120003 predicted 585
2 SASI_Mm01_00120004 predicted 231
3 SASI_Mm01_00120006 predicted 391
4 SASI_Mm01_00120007 predicted 210
5 SASI_Mm01_00120008 predicted 469
6 SASI_Mm01_00120009 predicted 478
7 SASI_Mm01_00120010 predicted 468
8 SASI_Mm01_00120011 predicted 517
9 SASI_Mm01_00120012 predicted 302
10 SASI_Mm02_00330003 predicted 314
11 SASI_Mm01_00120005 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026304
VALIDATED
l7Rn6 MISSION shRNA Bacterial Glycerol Stock
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-676s21c1
Sequence:CCGGGACACCAAATCCATCAGAAATCTCGAGATTTCTGATGGATTTGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.1-590s1c1
Sequence:CCGGCGTTGACTCCTTTACGCAGTTCTCGAGAACTGCGTAAAGGAGTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-234s21c1
Sequence:CCGGAGCAAGTGGCAGAGGATAAATCTCGAGATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-471s21c1
Sequence:CCGGACCCATTTGGAGCCATGAATACTCGAGTATTCATGGCTCCAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-621s21c1
Sequence:CCGGTGTTGGACAACTTCTACAATTCTCGAGAATTGTAGAAGTTGTCCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.2-235s1c1
Sequence:CCGGGCAAGTGGCAGAGGATAAATTCTCGAGAATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.2-472s1c1
Sequence:CCGGCCCATTTGGAGCCATGAATATCTCGAGATATTCATGGCTCCAAATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.1-410s1c1
Sequence:CCGGGAATGGAAAGCCAAGTGCCATCTCGAGATGGCACTTGGCTTTCCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-864s21c1
Sequence:CCGGTAGTGACTATGAGACTTATAACTCGAGTTATAAGTCTCATAGTCACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026304
VALIDATED
l7Rn6 MISSION shRNA shRNA Plasmid DNA
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-676s21c1
Sequence:CCGGGACACCAAATCCATCAGAAATCTCGAGATTTCTGATGGATTTGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.1-590s1c1
Sequence:CCGGCGTTGACTCCTTTACGCAGTTCTCGAGAACTGCGTAAAGGAGTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-234s21c1
Sequence:CCGGAGCAAGTGGCAGAGGATAAATCTCGAGATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-471s21c1
Sequence:CCGGACCCATTTGGAGCCATGAATACTCGAGTATTCATGGCTCCAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-621s21c1
Sequence:CCGGTGTTGGACAACTTCTACAATTCTCGAGAATTGTAGAAGTTGTCCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.2-235s1c1
Sequence:CCGGGCAAGTGGCAGAGGATAAATTCTCGAGAATTTATCCTCTGCCACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.2-472s1c1
Sequence:CCGGCCCATTTGGAGCCATGAATATCTCGAGATATTCATGGCTCCAAATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.1-410s1c1
Sequence:CCGGGAATGGAAAGCCAAGTGCCATCTCGAGATGGCACTTGGCTTTCCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-864s21c1
Sequence:CCGGTAGTGACTATGAGACTTATAACTCGAGTTATAAGTCTCATAGTCACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026304
VALIDATED
l7Rn6 MISSION shRNA Lentiviral Transduction Particles
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-676s21c1
Sequence:CCGGGACACCAAATCCATCAGAAATCTCGAGATTTCTGATGGATTTGGTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000183976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.1-590s1c1
Sequence:CCGGCGTTGACTCCTTTACGCAGTTCTCGAGAACTGCGTAAAGGAGTCAACGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-234s21c1
Sequence:CCGGAGCAAGTGGCAGAGGATAAATCTCGAGATTTATCCTCTGCCACTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-471s21c1
Sequence:CCGGACCCATTTGGAGCCATGAATACTCGAGTATTCATGGCTCCAAATGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-621s21c1
Sequence:CCGGTGTTGGACAACTTCTACAATTCTCGAGAATTGTAGAAGTTGTCCAACATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.2-235s1c1
Sequence:CCGGGCAAGTGGCAGAGGATAAATTCTCGAGAATTTATCCTCTGCCACTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000217239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.2-472s1c1
Sequence:CCGGCCCATTTGGAGCCATGAATATCTCGAGATATTCATGGCTCCAAATGGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000184544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026304.1-410s1c1
Sequence:CCGGGAATGGAAAGCCAAGTGCCATCTCGAGATGGCACTTGGCTTTCCATTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000250903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026304.2-864s21c1
Sequence:CCGGTAGTGACTATGAGACTTATAACTCGAGTTATAAGTCTCATAGTCACTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???