EMAIL THIS PAGE TO A FRIEND

LACC1

laccase (multicopper oxidoreductase) domain containing 1

76 Gene Product Result for
Synonyms: C13orf31
UniProtKB ID: Q8IV20, A2A3Z6, Q8N8X5
Gene ID:
Mouse(210808) laccase (multicopper oxidoreductase) domain containing 1
Rat(313790) laccase (multicopper oxidoreductase) domain containing 1
chicken(418840) laccase (multicopper oxidoreductase) domain containing 1
cow(537649) laccase (multicopper oxidoreductase) domain containing 1
dog(476928) laccase (multicopper oxidoreductase) domain containing 1
domestic cat(101086030) laccase (multicopper oxidoreductase) domain containing 1
sheep(101109625) laccase (multicopper oxidoreductase) domain containing 1
domestic guinea pig(100714334) laccase (multicopper oxidoreductase) domain containing 1
naked mole-rat(101722043) laccase (multicopper oxidoreductase) domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172488 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172488 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172488 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153218 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153218 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153218 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128303 Rosetta Predictions human pricing
NM_153218 Rosetta Predictions human pricing
XM_001072262 Rosetta Predictions rat pricing
XM_233749 Rosetta Predictions rat pricing
NM_172488 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331026 predicted 508
2 SASI_Hs02_00331027 predicted 619
3 SASI_Hs02_00331028 predicted 947
4 SASI_Hs02_00331029 predicted 1236
5 SASI_Hs02_00331030 predicted 1594
6 SASI_Hs02_00331031 predicted 1278
7 SASI_Hs02_00331032 predicted 1079
8 SASI_Hs02_00331033 predicted 1578
9 SASI_Hs02_00331034 predicted 956
10 SASI_Hs02_00331035 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153218 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240206 predicted 349
2 SASI_Hs01_00240207 predicted 452
3 SASI_Hs02_00367079 predicted 779
4 SASI_Hs01_00240208 predicted 1438
5 SASI_Hs01_00240210 predicted 1111
6 SASI_Hs01_00240211 predicted 918
7 SASI_Hs01_00240212 predicted 1416
8 SASI_Hs01_00240213 predicted 788
9 SASI_Hs01_00240214 predicted 765
10 SASI_Hs01_00240215 predicted 1364
11 SASI_Hs01_00240209 predicted 1452
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338457 predicted 929
2 SASI_Rn02_00338458 predicted 388
3 SASI_Rn02_00338459 predicted 1143
4 SASI_Rn02_00338460 predicted 449
5 SASI_Rn02_00338461 predicted 412
6 SASI_Rn02_00338462 predicted 862
7 SASI_Rn02_00338463 predicted 415
8 SASI_Rn02_00338464 predicted 624
9 SASI_Rn02_00338465 predicted 1125
10 SASI_Rn02_00338466 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388020 predicted 921
2 SASI_Rn02_00388021 predicted 1143
3 SASI_Rn02_00388022 predicted 925
4 SASI_Rn02_00388023 predicted 860
5 SASI_Rn02_00388024 predicted 983
6 SASI_Rn02_00388025 predicted 866
7 SASI_Rn02_00388026 predicted 1129
8 SASI_Rn02_00388027 predicted 1148
9 SASI_Rn02_00388028 predicted 1122
10 SASI_Rn02_00388029 predicted 1096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172488 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077638 predicted 465
2 SASI_Mm01_00077640 predicted 513
3 SASI_Mm01_00077641 predicted 887
4 SASI_Mm01_00077642 predicted 914
5 SASI_Mm01_00077643 predicted 368
6 SASI_Mm01_00077644 predicted 692
7 SASI_Mm01_00077645 predicted 1039
8 SASI_Mm01_00077646 predicted 720
9 SASI_Mm01_00077647 predicted 797
10 SASI_Mm02_00344057 predicted 737
11 SASI_Mm01_00077639 predicted 785
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172488
VALIDATED
LACC1 MISSION shRNA Bacterial Glycerol Stock
laccase (multicopper oxidoreductase) domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-604s1c1
Sequence:CCGGGCTGCCTCTTTGTATACAATTCTCGAGAATTGTATACAAAGAGGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-828s1c1
Sequence:CCGGCATCCAGCATGAAATAGAAACCTCGAGGTTTCTATTTCATGCTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172488.1-1866s1c1
Sequence:CCGGCGTTCTCTGTATTTGTCTATACTCGAGTATAGACAAATACAGAGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-1978s1c1
Sequence:CCGGGCTTTCTCATTTGAAGCAGATCTCGAGATCTGCTTCAAATGAGAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-2212s1c1
Sequence:CCGGCCACAAATTTACAGATCCATACTCGAGTATGGATCTGTAAATTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.1-1058s1c1
Sequence:CCGGGCCGGATTTAACGCAGAGAAACTCGAGTTTCTCTGCGTTAAATCCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-913s1c1
Sequence:CCGGGACAACTTCCTGCATGGATTTCTCGAGAAATCCATGCAGGAAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-780s1c1
Sequence:CCGGGAAACCATCCACTGGAATAAACTCGAGTTTATTCCAGTGGATGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-1479s1c1
Sequence:CCGGCCACCAGGATTCTTCTAGAAACTCGAGTTTCTAGAAGAATCCTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172488
VALIDATED
LACC1 MISSION shRNA shRNA Plasmid DNA
laccase (multicopper oxidoreductase) domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-604s1c1
Sequence:CCGGGCTGCCTCTTTGTATACAATTCTCGAGAATTGTATACAAAGAGGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-828s1c1
Sequence:CCGGCATCCAGCATGAAATAGAAACCTCGAGGTTTCTATTTCATGCTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172488.1-1866s1c1
Sequence:CCGGCGTTCTCTGTATTTGTCTATACTCGAGTATAGACAAATACAGAGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-1978s1c1
Sequence:CCGGGCTTTCTCATTTGAAGCAGATCTCGAGATCTGCTTCAAATGAGAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-2212s1c1
Sequence:CCGGCCACAAATTTACAGATCCATACTCGAGTATGGATCTGTAAATTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.1-1058s1c1
Sequence:CCGGGCCGGATTTAACGCAGAGAAACTCGAGTTTCTCTGCGTTAAATCCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-913s1c1
Sequence:CCGGGACAACTTCCTGCATGGATTTCTCGAGAAATCCATGCAGGAAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-780s1c1
Sequence:CCGGGAAACCATCCACTGGAATAAACTCGAGTTTATTCCAGTGGATGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-1479s1c1
Sequence:CCGGCCACCAGGATTCTTCTAGAAACTCGAGTTTCTAGAAGAATCCTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172488
VALIDATED
LACC1 MISSION shRNA Lentiviral Transduction Particles
laccase (multicopper oxidoreductase) domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-604s1c1
Sequence:CCGGGCTGCCTCTTTGTATACAATTCTCGAGAATTGTATACAAAGAGGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-828s1c1
Sequence:CCGGCATCCAGCATGAAATAGAAACCTCGAGGTTTCTATTTCATGCTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172488.1-1866s1c1
Sequence:CCGGCGTTCTCTGTATTTGTCTATACTCGAGTATAGACAAATACAGAGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-1978s1c1
Sequence:CCGGGCTTTCTCATTTGAAGCAGATCTCGAGATCTGCTTCAAATGAGAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-2212s1c1
Sequence:CCGGCCACAAATTTACAGATCCATACTCGAGTATGGATCTGTAAATTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.1-1058s1c1
Sequence:CCGGGCCGGATTTAACGCAGAGAAACTCGAGTTTCTCTGCGTTAAATCCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-913s1c1
Sequence:CCGGGACAACTTCCTGCATGGATTTCTCGAGAAATCCATGCAGGAAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172488.2-780s1c1
Sequence:CCGGGAAACCATCCACTGGAATAAACTCGAGTTTATTCCAGTGGATGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172488.1-1479s1c1
Sequence:CCGGCCACCAGGATTCTTCTAGAAACTCGAGTTTCTAGAAGAATCCTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153218
VALIDATED
LACC1 MISSION shRNA Bacterial Glycerol Stock
laccase (multicopper oxidoreductase) domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-2125s1c1
Sequence:CCGGGCTCGAAAGATGTAGAGGTTTCTCGAGAAACCTCTACATCTTTCGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1860s1c1
Sequence:CCGGCCCTGTTTATTACACAGATCACTCGAGTGATCTGTGTAATAAACAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1393s1c1
Sequence:CCGGCCTGCATGTGTACAACTATTTCTCGAGAAATAGTTGTACACATGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1580s1c1
Sequence:CCGGGTACACAGATTGGCTTCATATCTCGAGATATGAAGCCAATCTGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153218.1-461s1c1
Sequence:CCGGGCAGTAACATCAGCTATGAAACTCGAGTTTCATAGCTGATGTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1315s1c1
Sequence:CCGGGTTGTACTTGGACCTTCAGTACTCGAGTACTGAAGGTCCAAGTACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153218.1-1267s1c1
Sequence:CCGGGTGAATGCTATGATAGCAGAACTCGAGTTCTGCTATCATAGCATTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153218.1-2267s1c1
Sequence:CCGGCAGGTTGGAAACAGATAAGTACTCGAGTACTTATCTGTTTCCAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-2197s1c1
Sequence:CCGGGCATGAAACTGAAAGTGCATACTCGAGTATGCACTTTCAGTTTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153218
VALIDATED
LACC1 MISSION shRNA shRNA Plasmid DNA
laccase (multicopper oxidoreductase) domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-2125s1c1
Sequence:CCGGGCTCGAAAGATGTAGAGGTTTCTCGAGAAACCTCTACATCTTTCGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1860s1c1
Sequence:CCGGCCCTGTTTATTACACAGATCACTCGAGTGATCTGTGTAATAAACAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1393s1c1
Sequence:CCGGCCTGCATGTGTACAACTATTTCTCGAGAAATAGTTGTACACATGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1580s1c1
Sequence:CCGGGTACACAGATTGGCTTCATATCTCGAGATATGAAGCCAATCTGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153218.1-461s1c1
Sequence:CCGGGCAGTAACATCAGCTATGAAACTCGAGTTTCATAGCTGATGTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1315s1c1
Sequence:CCGGGTTGTACTTGGACCTTCAGTACTCGAGTACTGAAGGTCCAAGTACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153218.1-1267s1c1
Sequence:CCGGGTGAATGCTATGATAGCAGAACTCGAGTTCTGCTATCATAGCATTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153218.1-2267s1c1
Sequence:CCGGCAGGTTGGAAACAGATAAGTACTCGAGTACTTATCTGTTTCCAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-2197s1c1
Sequence:CCGGGCATGAAACTGAAAGTGCATACTCGAGTATGCACTTTCAGTTTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153218
VALIDATED
LACC1 MISSION shRNA Lentiviral Transduction Particles
laccase (multicopper oxidoreductase) domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-2125s1c1
Sequence:CCGGGCTCGAAAGATGTAGAGGTTTCTCGAGAAACCTCTACATCTTTCGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1860s1c1
Sequence:CCGGCCCTGTTTATTACACAGATCACTCGAGTGATCTGTGTAATAAACAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134034    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1393s1c1
Sequence:CCGGCCTGCATGTGTACAACTATTTCTCGAGAAATAGTTGTACACATGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1580s1c1
Sequence:CCGGGTACACAGATTGGCTTCATATCTCGAGATATGAAGCCAATCTGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153218.1-461s1c1
Sequence:CCGGGCAGTAACATCAGCTATGAAACTCGAGTTTCATAGCTGATGTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-1315s1c1
Sequence:CCGGGTTGTACTTGGACCTTCAGTACTCGAGTACTGAAGGTCCAAGTACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153218.1-1267s1c1
Sequence:CCGGGTGAATGCTATGATAGCAGAACTCGAGTTCTGCTATCATAGCATTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133778    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153218.1-2267s1c1
Sequence:CCGGCAGGTTGGAAACAGATAAGTACTCGAGTACTTATCTGTTTCCAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_153218.1-2197s1c1
Sequence:CCGGGCATGAAACTGAAAGTGCATACTCGAGTATGCACTTTCAGTTTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)