EMAIL THIS PAGE TO A FRIEND

LACE1

lactation elevated 1

68 Gene Product Result for
Synonyms: AFG1
UniProtKB ID: Q8WV93, Q8N6A3
Gene ID:
Human(246269) Summary: This gene encodes a protein with possible ATPase function. The protein contains a P-loop motif and a five-domain structure that is conserved in fly, yeast, and bacteria. Two conserved estrogen receptor binding sites are located within 2.5 kb of this gene. [provided by RefSeq, Jul 2008]
Mouse(215951) lactation elevated 1
Rat(502479) lactation elevated 1
chicken(421770) lactation elevated 1
dog(481952) lactation elevated 1
Horse(100066538) lactation elevated 1
cow(537689) lactation elevated 1
domestic cat(101098634) lactation elevated 1
domestic guinea pig(100729240) lactation elevated 1
naked mole-rat(101699966) lactation elevated 1
sheep(101116838) lactation elevated 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145315 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145315 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145315 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145315 Rosetta Predictions human pricing
NM_001037656 Rosetta Predictions rat pricing
XM_001065035 Rosetta Predictions rat pricing
NM_145743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145315 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00080847 predicted 748
2 SASI_Hs01_00080848 predicted 768
3 SASI_Hs01_00080849 predicted 792
4 SASI_Hs01_00080851 predicted 444
5 SASI_Hs01_00080852 predicted 1371
6 SASI_Hs01_00080853 predicted 956
7 SASI_Hs02_00365219 predicted 1347
8 SASI_Hs01_00080854 predicted 987
9 SASI_Hs02_00365220 predicted 1561
10 SASI_Hs01_00080856 predicted 1217
11 SASI_Hs01_00080850 predicted 1316
12 SASI_Hs01_00080855 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036215 predicted 1050
2 SASI_Rn01_00036216 predicted 619
3 SASI_Rn01_00036217 predicted 862
4 SASI_Rn02_00204538 predicted 605
5 SASI_Rn01_00036218 predicted 1256
6 SASI_Rn01_00036219 predicted 876
7 SASI_Rn01_00036220 predicted 1594
8 SASI_Rn01_00036221 predicted 1258
9 SASI_Rn01_00036222 predicted 871
10 SASI_Rn01_00036223 predicted 521
11 SASI_Rn01_00036224 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312630 predicted 483
2 SASI_Rn02_00312631 predicted 418
3 SASI_Rn02_00312632 predicted 485
4 SASI_Rn02_00312633 predicted 409
5 SASI_Rn02_00312634 predicted 509
6 SASI_Rn02_00312635 predicted 492
7 SASI_Rn02_00312636 predicted 505
8 SASI_Rn02_00312637 predicted 492
9 SASI_Rn02_00312638 predicted 454
10 SASI_Rn02_00312639 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341273 predicted 931
2 SASI_Mm02_00341274 predicted 1601
3 SASI_Mm01_00164907 predicted 628
4 SASI_Mm02_00341275 predicted 929
5 SASI_Mm02_00341276 predicted 1328
6 SASI_Mm02_00341277 predicted 1333
7 SASI_Mm01_00164909 predicted 357
8 SASI_Mm01_00164910 predicted 685
9 SASI_Mm02_00341278 predicted 1358
10 SASI_Mm02_00341279 predicted 776
11 SASI_Mm01_00164905 predicted 1012
12 SASI_Mm01_00164906 predicted 242
13 SASI_Mm01_00164908 predicted 424
14 SASI_Mm01_00164911 predicted 397
15 SASI_Mm01_00164912 predicted 1524
16 SASI_Mm01_00164913 predicted 1005
17 SASI_Mm01_00164914 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145743
VALIDATED
LACE1 MISSION shRNA Bacterial Glycerol Stock
lactation elevated 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-831s21c1
Sequence:CCGGGCCATGATTCTGAAACAGCTTCTCGAGAAGCTGTTTCAGAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-1077s21c1
Sequence:CCGGGCCGTCGTGGATAAGTTGTTTCTCGAGAAACAACTTATCCACGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-721s21c1
Sequence:CCGGCGGGATTCATGGCTAAGTCATCTCGAGATGACTTAGCCATGAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145743.2-1793s21c1
Sequence:CCGGCCTTTGTAGATCCGAGTTTATCTCGAGATAAACTCGGATCTACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-1358s21c1
Sequence:CCGGTGACTTCAAGGTGCGCATTATCTCGAGATAATGCGCACCTTGAAGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-1642s1c1
Sequence:CCGGCCTTTGTAGATCCGAGTTTATCTCGAGATAAACTCGGATCTACAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-926s1c1
Sequence:CCGGGCCGTCGTGGATAAGTTGTTTCTCGAGAAACAACTTATCCACGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-680s1c1
Sequence:CCGGGCCATGATTCTGAAACAGCTTCTCGAGAAGCTGTTTCAGAATCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-570s1c1
Sequence:CCGGCGGGATTCATGGCTAAGTCATCTCGAGATGACTTAGCCATGAATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-676s1c1
Sequence:CCGGCGACGCCATGATTCTGAAACACTCGAGTGTTTCAGAATCATGGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145743
VALIDATED
LACE1 MISSION shRNA shRNA Plasmid DNA
lactation elevated 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-831s21c1
Sequence:CCGGGCCATGATTCTGAAACAGCTTCTCGAGAAGCTGTTTCAGAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-1077s21c1
Sequence:CCGGGCCGTCGTGGATAAGTTGTTTCTCGAGAAACAACTTATCCACGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-721s21c1
Sequence:CCGGCGGGATTCATGGCTAAGTCATCTCGAGATGACTTAGCCATGAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145743.2-1793s21c1
Sequence:CCGGCCTTTGTAGATCCGAGTTTATCTCGAGATAAACTCGGATCTACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-1358s21c1
Sequence:CCGGTGACTTCAAGGTGCGCATTATCTCGAGATAATGCGCACCTTGAAGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-1642s1c1
Sequence:CCGGCCTTTGTAGATCCGAGTTTATCTCGAGATAAACTCGGATCTACAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-926s1c1
Sequence:CCGGGCCGTCGTGGATAAGTTGTTTCTCGAGAAACAACTTATCCACGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-680s1c1
Sequence:CCGGGCCATGATTCTGAAACAGCTTCTCGAGAAGCTGTTTCAGAATCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-570s1c1
Sequence:CCGGCGGGATTCATGGCTAAGTCATCTCGAGATGACTTAGCCATGAATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-676s1c1
Sequence:CCGGCGACGCCATGATTCTGAAACACTCGAGTGTTTCAGAATCATGGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145743
VALIDATED
LACE1 MISSION shRNA Lentiviral Transduction Particles
lactation elevated 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-831s21c1
Sequence:CCGGGCCATGATTCTGAAACAGCTTCTCGAGAAGCTGTTTCAGAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-1077s21c1
Sequence:CCGGGCCGTCGTGGATAAGTTGTTTCTCGAGAAACAACTTATCCACGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-721s21c1
Sequence:CCGGCGGGATTCATGGCTAAGTCATCTCGAGATGACTTAGCCATGAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336124    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145743.2-1793s21c1
Sequence:CCGGCCTTTGTAGATCCGAGTTTATCTCGAGATAAACTCGGATCTACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145743.2-1358s21c1
Sequence:CCGGTGACTTCAAGGTGCGCATTATCTCGAGATAATGCGCACCTTGAAGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121012    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-1642s1c1
Sequence:CCGGCCTTTGTAGATCCGAGTTTATCTCGAGATAAACTCGGATCTACAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-926s1c1
Sequence:CCGGGCCGTCGTGGATAAGTTGTTTCTCGAGAAACAACTTATCCACGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-680s1c1
Sequence:CCGGGCCATGATTCTGAAACAGCTTCTCGAGAAGCTGTTTCAGAATCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-570s1c1
Sequence:CCGGCGGGATTCATGGCTAAGTCATCTCGAGATGACTTAGCCATGAATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145743.1-676s1c1
Sequence:CCGGCGACGCCATGATTCTGAAACACTCGAGTGTTTCAGAATCATGGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145315
LACE1 MISSION shRNA Bacterial Glycerol Stock
lactation elevated 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-501s1c1
Sequence:CCGGCGAGGACCTTAAAGGATACAACTCGAGTTGTATCCTTTAAGGTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-1576s1c1
Sequence:CCGGCTCACGGAAATGCAGACTGAACTCGAGTTCAGTCTGCATTTCCGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1510s1c1
Sequence:CCGGGCAGAAGGACTCTCCATGTTTCTCGAGAAACATGGAGAGTCCTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-1335s1c1
Sequence:CCGGCAGGACTCAAGGTCGAAGATTCTCGAGAATCTTCGACCTTGAGTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1099s1c1
Sequence:CCGGGCTGTCATGGATAAGTTGTTTCTCGAGAAACAACTTATCCATGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-502s1c1
Sequence:CCGGGAGGACCTTAAAGGATACAATCTCGAGATTGTATCCTTTAAGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-978s1c1
Sequence:CCGGCATAGCAGTCTTGAAGGAATACTCGAGTATTCCTTCAAGACTGCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-442s1c1
Sequence:CCGGCATGAGCTAAAGGATGATGAACTCGAGTTCATCATCCTTTAGCTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1469s1c1
Sequence:CCGGGCAGAATACTGATGGATGATTCTCGAGAATCATCCATCAGTATTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145315
LACE1 MISSION shRNA shRNA Plasmid DNA
lactation elevated 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-501s1c1
Sequence:CCGGCGAGGACCTTAAAGGATACAACTCGAGTTGTATCCTTTAAGGTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-1576s1c1
Sequence:CCGGCTCACGGAAATGCAGACTGAACTCGAGTTCAGTCTGCATTTCCGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1510s1c1
Sequence:CCGGGCAGAAGGACTCTCCATGTTTCTCGAGAAACATGGAGAGTCCTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-1335s1c1
Sequence:CCGGCAGGACTCAAGGTCGAAGATTCTCGAGAATCTTCGACCTTGAGTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1099s1c1
Sequence:CCGGGCTGTCATGGATAAGTTGTTTCTCGAGAAACAACTTATCCATGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-502s1c1
Sequence:CCGGGAGGACCTTAAAGGATACAATCTCGAGATTGTATCCTTTAAGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-978s1c1
Sequence:CCGGCATAGCAGTCTTGAAGGAATACTCGAGTATTCCTTCAAGACTGCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-442s1c1
Sequence:CCGGCATGAGCTAAAGGATGATGAACTCGAGTTCATCATCCTTTAGCTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1469s1c1
Sequence:CCGGGCAGAATACTGATGGATGATTCTCGAGAATCATCCATCAGTATTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145315
LACE1 MISSION shRNA Lentiviral Transduction Particles
lactation elevated 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-501s1c1
Sequence:CCGGCGAGGACCTTAAAGGATACAACTCGAGTTGTATCCTTTAAGGTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-1576s1c1
Sequence:CCGGCTCACGGAAATGCAGACTGAACTCGAGTTCAGTCTGCATTTCCGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1510s1c1
Sequence:CCGGGCAGAAGGACTCTCCATGTTTCTCGAGAAACATGGAGAGTCCTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-1335s1c1
Sequence:CCGGCAGGACTCAAGGTCGAAGATTCTCGAGAATCTTCGACCTTGAGTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1099s1c1
Sequence:CCGGGCTGTCATGGATAAGTTGTTTCTCGAGAAACAACTTATCCATGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-502s1c1
Sequence:CCGGGAGGACCTTAAAGGATACAATCTCGAGATTGTATCCTTTAAGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145315.2-978s1c1
Sequence:CCGGCATAGCAGTCTTGAAGGAATACTCGAGTATTCCTTCAAGACTGCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-442s1c1
Sequence:CCGGCATGAGCTAAAGGATGATGAACTCGAGTTCATCATCCTTTAGCTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145315.2-1469s1c1
Sequence:CCGGGCAGAATACTGATGGATGATTCTCGAGAATCATCCATCAGTATTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)