EMAIL THIS PAGE TO A FRIEND

LACRT

lacritin

17 Gene Product Result for
Species: Human LACRT(90070)
UniProtKB ID: Q9GZZ8
Gene ID:
Human(90070) Summary: The protein encoded by this gene is highly expressed in the lacrimal glands and localized primarily to secretory granules and secretory fluid. It augments lacrimal acinar cell secretion, promotes ductal cell proliferation, and stimulates signaling through tyrosine phosphorylation and release of calcium. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302269 ANTI-LACRT (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033277 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151181 MISSION® esiRNA esiRNA human LACRT (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033277 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073101 predicted 247
2 SASI_Hs01_00073102 predicted 211
3 SASI_Hs01_00073103 predicted 219
4 SASI_Hs01_00073104 predicted 253
5 SASI_Hs01_00073105 predicted 257
6 SASI_Hs01_00073106 predicted 240
7 SASI_Hs01_00073107 predicted 259
8 SASI_Hs01_00073108 predicted 256
9 SASI_Hs02_00361081 predicted 142
10 SASI_Hs02_00361082 predicted 159
11 SASI_Hs01_00073100 predicted 212
12 SASI_Hs01_00073109 predicted 52
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033277
LACRT MISSION shRNA Bacterial Glycerol Stock
lacritin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033277.1-263s1c1
Sequence:CCGGCTCAAGCAGGCAGGAACTAAACTCGAGTTTAGTTCCTGCCTGCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033277.1-310s1c1
Sequence:CCGGGTATCTTACTAACAGAACAAGCTCGAGCTTGTTCTGTTAGTAAGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-142s21c1
Sequence:CCGGCTGGGACCTCTAAGCCTAATGCTCGAGCATTAGGCTTAGAGGTCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-165s21c1
Sequence:CCGGGAGATCTCAGGTCCAGCAGAACTCGAGTTCTGCTGGACCTGAGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-288s21c1
Sequence:CCGGCTGAAATCCATAGTGGAGAAACTCGAGTTTCTCCACTATGGATTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-81s21c1
Sequence:CCGGGCCCTGGTCTATGCTGAAGATCTCGAGATCTTCAGCATAGACCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-263s21c1
Sequence:CCGGCTCAAGCAGGCAGGAACTAAACTCGAGTTTAGTTCCTGCCTGCTTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033277
LACRT MISSION shRNA shRNA Plasmid DNA
lacritin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033277.1-263s1c1
Sequence:CCGGCTCAAGCAGGCAGGAACTAAACTCGAGTTTAGTTCCTGCCTGCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033277.1-310s1c1
Sequence:CCGGGTATCTTACTAACAGAACAAGCTCGAGCTTGTTCTGTTAGTAAGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-142s21c1
Sequence:CCGGCTGGGACCTCTAAGCCTAATGCTCGAGCATTAGGCTTAGAGGTCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-165s21c1
Sequence:CCGGGAGATCTCAGGTCCAGCAGAACTCGAGTTCTGCTGGACCTGAGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-288s21c1
Sequence:CCGGCTGAAATCCATAGTGGAGAAACTCGAGTTTCTCCACTATGGATTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-81s21c1
Sequence:CCGGGCCCTGGTCTATGCTGAAGATCTCGAGATCTTCAGCATAGACCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-263s21c1
Sequence:CCGGCTCAAGCAGGCAGGAACTAAACTCGAGTTTAGTTCCTGCCTGCTTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033277
LACRT MISSION shRNA Lentiviral Transduction Particles
lacritin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172277    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033277.1-263s1c1
Sequence:CCGGCTCAAGCAGGCAGGAACTAAACTCGAGTTTAGTTCCTGCCTGCTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033277.1-310s1c1
Sequence:CCGGGTATCTTACTAACAGAACAAGCTCGAGCTTGTTCTGTTAGTAAGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-142s21c1
Sequence:CCGGCTGGGACCTCTAAGCCTAATGCTCGAGCATTAGGCTTAGAGGTCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-165s21c1
Sequence:CCGGGAGATCTCAGGTCCAGCAGAACTCGAGTTCTGCTGGACCTGAGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-288s21c1
Sequence:CCGGCTGAAATCCATAGTGGAGAAACTCGAGTTTCTCCACTATGGATTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-81s21c1
Sequence:CCGGGCCCTGGTCTATGCTGAAGATCTCGAGATCTTCAGCATAGACCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033277.1-263s21c1
Sequence:CCGGCTCAAGCAGGCAGGAACTAAACTCGAGTTTAGTTCCTGCCTGCTTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)