EMAIL THIS PAGE TO A FRIEND

LACTB2

lactamase, beta 2

78 Gene Product Result for
UniProtKB ID: Q53H82, Q9Y392
Gene ID:
Mouse(212442) lactamase, beta 2
Rat(297768) lactamase, beta 2
domestic guinea pig(100734600) lactamase, beta 2
sheep(101104760) lactamase, beta 2
chicken(420178) lactamase, beta 2
chicken(776621) lactamase, beta 2
dog(486990) lactamase, beta 2
domestic cat(101095150) lactamase, beta 2
cow(535021) lactamase, beta 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016027 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016027 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016027 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016027 Rosetta Predictions human pricing
NM_001024247 Rosetta Predictions rat pricing
NM_145381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348726 predicted 242
2 SASI_Hs01_00097299 predicted 379
3 SASI_Hs01_00097301 predicted 253
4 SASI_Hs02_00348727 predicted 259
5 SASI_Hs01_00097302 predicted 430
6 SASI_Hs01_00097303 predicted 425
7 SASI_Hs01_00097304 predicted 543
8 SASI_Hs01_00097305 predicted 202
9 SASI_Hs01_00097306 predicted 465
10 SASI_Hs01_00097307 predicted 559
11 SASI_Hs01_00097298 predicted 344
12 SASI_Hs01_00097300 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024247 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121224 predicted 394
2 SASI_Rn01_00121225 predicted 482
3 SASI_Rn01_00121226 predicted 208
4 SASI_Rn02_00202406 predicted 426
5 SASI_Rn01_00121227 predicted 579
6 SASI_Rn01_00121228 predicted 476
7 SASI_Rn01_00121229 predicted 579
8 SASI_Rn01_00121230 predicted 234
9 SASI_Rn01_00121231 predicted 644
10 SASI_Rn01_00121232 predicted 301
11 SASI_Rn01_00121233 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059826 predicted 914
2 SASI_Mm01_00059827 predicted 767
3 SASI_Mm01_00059828 predicted 385
4 SASI_Mm01_00059829 predicted 828
5 SASI_Mm01_00059830 predicted 214
6 SASI_Mm01_00059832 predicted 592
7 SASI_Mm01_00059833 predicted 788
8 SASI_Mm01_00059834 predicted 883
9 SASI_Mm01_00059835 predicted 683
10 SASI_Mm02_00340694 predicted 236
11 SASI_Mm01_00059831 predicted 498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145381
VALIDATED
LACTB2 MISSION shRNA Bacterial Glycerol Stock
lactamase, beta 2
Mouse
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-1095s21c1
Sequence:CCGGAGGACAGGTTACTGATCTAACCTCGAGGTTAGATCAGTAACCTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-905s21c1
Sequence:CCGGGAAATGGAAAGCCGTCCTTTACTCGAGTAAAGGACGGCTTTCCATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-1041s21c1
Sequence:CCGGGATACTTGTAATCCGTGATAACTCGAGTTATCACGGATTACAAGTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-310s1c1
Sequence:CCGGGAGGCATTGTAGACATTTGTACTCGAGTACAAATGTCTACAATGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-831s1c1
Sequence:CCGGGAGCATAATCTCTTGCTTCATCTCGAGATGAAGCAAGAGATTATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-905s1c1
Sequence:CCGGGAAATGGAAAGCCGTCCTTTACTCGAGTAAAGGACGGCTTTCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-828s1c1
Sequence:CCGGGCAGAGCATAATCTCTTGCTTCTCGAGAAGCAAGAGATTATGCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-203s1c1
Sequence:CCGGCGAGCCTTCAGTTCCAGAATACTCGAGTATTCTGGAACTGAAGGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145381.1-1320s1c1
Sequence:CCGGGCTGGCTTACAGTTCAGAGATCTCGAGATCTCTGAACTGTAAGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-716s1c1
Sequence:CCGGCCGAGAAGAACAGATTATTTCCTCGAGGAAATAATCTGTTCTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-207s1c1
Sequence:CCGGCCATCAGTTCCAGAATATATCCTCGAGGATATATTCTGGAACTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-605s1c1
Sequence:CCGGCTCCCTAAACAACTTACTAAACTCGAGTTTAGTAAGTTGTTTAGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145381.2-831s21c1
Sequence:CCGGGAGCATAATCTCTTGCTTCATCTCGAGATGAAGCAAGAGATTATGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-777s1c1
Sequence:CCGGGAACTTAGGACAATGATTTACCTCGAGGTAAATCATTGTCCTAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145381.2-1211s1c1
Sequence:CCGGGAACAATTCAAACCAGTTAATCTCGAGATTAACTGGTTTGAATTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-558s21c1
Sequence:CCGGCTAGGAGAAGGGACGACAATACTCGAGTATTGTCGTCCCTTCTCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145381.2-715s21c1
Sequence:CCGGACCGAGAAGAACAGATTATTTCTCGAGAAATAATCTGTTCTTCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145381
VALIDATED
LACTB2 MISSION shRNA shRNA Plasmid DNA
lactamase, beta 2
Mouse
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-1095s21c1
Sequence:CCGGAGGACAGGTTACTGATCTAACCTCGAGGTTAGATCAGTAACCTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-905s21c1
Sequence:CCGGGAAATGGAAAGCCGTCCTTTACTCGAGTAAAGGACGGCTTTCCATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-1041s21c1
Sequence:CCGGGATACTTGTAATCCGTGATAACTCGAGTTATCACGGATTACAAGTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-310s1c1
Sequence:CCGGGAGGCATTGTAGACATTTGTACTCGAGTACAAATGTCTACAATGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-831s1c1
Sequence:CCGGGAGCATAATCTCTTGCTTCATCTCGAGATGAAGCAAGAGATTATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-905s1c1
Sequence:CCGGGAAATGGAAAGCCGTCCTTTACTCGAGTAAAGGACGGCTTTCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-828s1c1
Sequence:CCGGGCAGAGCATAATCTCTTGCTTCTCGAGAAGCAAGAGATTATGCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-203s1c1
Sequence:CCGGCGAGCCTTCAGTTCCAGAATACTCGAGTATTCTGGAACTGAAGGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145381.1-1320s1c1
Sequence:CCGGGCTGGCTTACAGTTCAGAGATCTCGAGATCTCTGAACTGTAAGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-716s1c1
Sequence:CCGGCCGAGAAGAACAGATTATTTCCTCGAGGAAATAATCTGTTCTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-207s1c1
Sequence:CCGGCCATCAGTTCCAGAATATATCCTCGAGGATATATTCTGGAACTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-605s1c1
Sequence:CCGGCTCCCTAAACAACTTACTAAACTCGAGTTTAGTAAGTTGTTTAGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145381.2-831s21c1
Sequence:CCGGGAGCATAATCTCTTGCTTCATCTCGAGATGAAGCAAGAGATTATGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-777s1c1
Sequence:CCGGGAACTTAGGACAATGATTTACCTCGAGGTAAATCATTGTCCTAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145381.2-1211s1c1
Sequence:CCGGGAACAATTCAAACCAGTTAATCTCGAGATTAACTGGTTTGAATTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-558s21c1
Sequence:CCGGCTAGGAGAAGGGACGACAATACTCGAGTATTGTCGTCCCTTCTCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145381.2-715s21c1
Sequence:CCGGACCGAGAAGAACAGATTATTTCTCGAGAAATAATCTGTTCTTCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145381
VALIDATED
LACTB2 MISSION shRNA Lentiviral Transduction Particles
lactamase, beta 2
Mouse
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-1095s21c1
Sequence:CCGGAGGACAGGTTACTGATCTAACCTCGAGGTTAGATCAGTAACCTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-905s21c1
Sequence:CCGGGAAATGGAAAGCCGTCCTTTACTCGAGTAAAGGACGGCTTTCCATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-1041s21c1
Sequence:CCGGGATACTTGTAATCCGTGATAACTCGAGTTATCACGGATTACAAGTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-310s1c1
Sequence:CCGGGAGGCATTGTAGACATTTGTACTCGAGTACAAATGTCTACAATGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-831s1c1
Sequence:CCGGGAGCATAATCTCTTGCTTCATCTCGAGATGAAGCAAGAGATTATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-905s1c1
Sequence:CCGGGAAATGGAAAGCCGTCCTTTACTCGAGTAAAGGACGGCTTTCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-828s1c1
Sequence:CCGGGCAGAGCATAATCTCTTGCTTCTCGAGAAGCAAGAGATTATGCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.1-203s1c1
Sequence:CCGGCGAGCCTTCAGTTCCAGAATACTCGAGTATTCTGGAACTGAAGGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145381.1-1320s1c1
Sequence:CCGGGCTGGCTTACAGTTCAGAGATCTCGAGATCTCTGAACTGTAAGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-716s1c1
Sequence:CCGGCCGAGAAGAACAGATTATTTCCTCGAGGAAATAATCTGTTCTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-207s1c1
Sequence:CCGGCCATCAGTTCCAGAATATATCCTCGAGGATATATTCTGGAACTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-605s1c1
Sequence:CCGGCTCCCTAAACAACTTACTAAACTCGAGTTTAGTAAGTTGTTTAGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145381.2-831s21c1
Sequence:CCGGGAGCATAATCTCTTGCTTCATCTCGAGATGAAGCAAGAGATTATGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145381.2-777s1c1
Sequence:CCGGGAACTTAGGACAATGATTTACCTCGAGGTAAATCATTGTCCTAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145381.2-1211s1c1
Sequence:CCGGGAACAATTCAAACCAGTTAATCTCGAGATTAACTGGTTTGAATTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145381.2-558s21c1
Sequence:CCGGCTAGGAGAAGGGACGACAATACTCGAGTATTGTCGTCCCTTCTCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145381.2-715s21c1
Sequence:CCGGACCGAGAAGAACAGATTATTTCTCGAGAAATAATCTGTTCTTCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016027
VALIDATED
LACTB2 MISSION shRNA Bacterial Glycerol Stock
lactamase, beta 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-538s21c1
Sequence:CCGGGGGAAGGAACAACGGTATTTGCTCGAGCAAATACCGTTGTTCCTTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016027.1-609s1c1
Sequence:CCGGGCTGATATTATATATCCAGGACTCGAGTCCTGGATATATAATATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016027.1-1222s1c1
Sequence:CCGGGCCGTTAGTTATCTATTACTACTCGAGTAGTAATAGATAACTAACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-321s21c1
Sequence:CCGGGACACTACCTATTGCATTAAACTCGAGTTTAATGCAATAGGTAGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-698s21c1
Sequence:CCGGGCAGCAAATTCTTACATTATTCTCGAGAATAATGTAAGAATTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-439s21c1
Sequence:CCGGCCACTCTAAGAGTTCTATATACTCGAGTATATAGAACTCTTAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016027.1-1218s21c1
Sequence:GTACCGGTTTGGCCGTTAGTTATCTATTCTCGAGAATAGATAACTAACGGCCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016027
VALIDATED
LACTB2 MISSION shRNA shRNA Plasmid DNA
lactamase, beta 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-538s21c1
Sequence:CCGGGGGAAGGAACAACGGTATTTGCTCGAGCAAATACCGTTGTTCCTTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016027.1-609s1c1
Sequence:CCGGGCTGATATTATATATCCAGGACTCGAGTCCTGGATATATAATATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016027.1-1222s1c1
Sequence:CCGGGCCGTTAGTTATCTATTACTACTCGAGTAGTAATAGATAACTAACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-321s21c1
Sequence:CCGGGACACTACCTATTGCATTAAACTCGAGTTTAATGCAATAGGTAGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-698s21c1
Sequence:CCGGGCAGCAAATTCTTACATTATTCTCGAGAATAATGTAAGAATTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-439s21c1
Sequence:CCGGCCACTCTAAGAGTTCTATATACTCGAGTATATAGAACTCTTAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016027.1-1218s21c1
Sequence:GTACCGGTTTGGCCGTTAGTTATCTATTCTCGAGAATAGATAACTAACGGCCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016027
VALIDATED
LACTB2 MISSION shRNA Lentiviral Transduction Particles
lactamase, beta 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-538s21c1
Sequence:CCGGGGGAAGGAACAACGGTATTTGCTCGAGCAAATACCGTTGTTCCTTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016027.1-609s1c1
Sequence:CCGGGCTGATATTATATATCCAGGACTCGAGTCCTGGATATATAATATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167790    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016027.1-1222s1c1
Sequence:CCGGGCCGTTAGTTATCTATTACTACTCGAGTAGTAATAGATAACTAACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-321s21c1
Sequence:CCGGGACACTACCTATTGCATTAAACTCGAGTTTAATGCAATAGGTAGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-698s21c1
Sequence:CCGGGCAGCAAATTCTTACATTATTCTCGAGAATAATGTAAGAATTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016027.1-439s21c1
Sequence:CCGGCCACTCTAAGAGTTCTATATACTCGAGTATATAGAACTCTTAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016027.1-1218s21c1
Sequence:GTACCGGTTTGGCCGTTAGTTATCTATTCTCGAGAATAGATAACTAACGGCCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)