EMAIL THIS PAGE TO A FRIEND

LACTB

lactamase, beta

75 Gene Product Result for
Synonyms: G24 MRPL56
UniProtKB ID: P83111, P83096
Gene ID:
Human(114294) Summary: This gene encodes a protein from the large 39S subunit of the mitochondrial ribosome (mitoribosome). The encoded protein has some sequence similarity to prokaryotic beta-lactamases but most of the residues that are responsible for the beta-lactamase activity are not conserved between the two proteins. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2010]
Mouse(80907) lactamase, beta
Rat(300803) lactamase, beta
Zebrafish(553619) lactamase, beta
cow(614196) lactamase, beta
domestic cat(101098717) lactamase, beta
dog(487588) lactamase, beta
chicken(415373) lactamase, beta
sheep(101101990) lactamase, beta
naked mole-rat(101714210) lactamase, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032857 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032857 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032857 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030717 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030717 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030717 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032857 Rosetta Predictions human pricing
NM_171846 Rosetta Predictions human pricing
NM_001106833 Rosetta Predictions rat pricing
NM_030717 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032857 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074914 predicted 848
2 SASI_Hs01_00074915 predicted 768
3 SASI_Hs01_00074916 predicted 849
4 SASI_Hs01_00074917 predicted 586
5 SASI_Hs01_00074918 predicted 682
6 SASI_Hs01_00074919 predicted 899
7 SASI_Hs01_00074920 predicted 519
8 SASI_Hs01_00074921 predicted 508
9 SASI_Hs01_00074922 predicted 686
10 SASI_Hs01_00074923 predicted 667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171846 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226799 predicted 849
2 SASI_Hs01_00226800 predicted 761
3 SASI_Hs01_00226801 predicted 850
4 SASI_Hs01_00226802 predicted 579
5 SASI_Hs01_00226803 predicted 674
6 SASI_Hs01_00226804 predicted 900
7 SASI_Hs01_00226805 predicted 515
8 SASI_Hs01_00226806 predicted 508
9 SASI_Hs01_00226807 predicted 688
10 SASI_Hs01_00226808 predicted 665
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106833 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222858 predicted 1643
2 SASI_Rn02_00222859 predicted 556
3 SASI_Rn02_00222860 predicted 493
4 SASI_Rn02_00222861 predicted 1349
5 SASI_Rn02_00222862 predicted 1678
6 SASI_Rn02_00222863 predicted 1253
7 SASI_Rn02_00222864 predicted 940
8 SASI_Rn02_00222865 predicted 995
9 SASI_Rn02_00222866 predicted 724
10 SASI_Rn02_00222867 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030717 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060974 predicted 999
2 SASI_Mm01_00060975 predicted 1642
3 SASI_Mm01_00060976 predicted 964
4 SASI_Mm01_00060978 predicted 1324
5 SASI_Mm01_00060979 predicted 497
6 SASI_Mm01_00060980 predicted 1261
7 SASI_Mm01_00060981 predicted 1740
8 SASI_Mm01_00060982 predicted 963
9 SASI_Mm01_00060983 predicted 775
10 SASI_Mm02_00336905 predicted 1105
11 SASI_Mm01_00060977 predicted 1646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032857
VALIDATED
LACTB MISSION shRNA Bacterial Glycerol Stock
lactamase, beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-577s21c1
Sequence:CCGGGCAGGGAAACTGGATCTTGATCTCGAGATCAAGATCCAGTTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032857.2-577s1c1
Sequence:CCGGGCAGGGAAACTGGATCTTGATCTCGAGATCAAGATCCAGTTTCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032857.2-1344s1c1
Sequence:CCGGCAAACCAGAAACAATGGTTATCTCGAGATAACCATTGTTTCTGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-1640s1c1
Sequence:CCGGCTTTGAAGATTGCCCTTGAATCTCGAGATTCAAGGGCAATCTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-1198s1c1
Sequence:CCGGCCTTACGTGGATAACTCCTATCTCGAGATAGGAGTTATCCACGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-412s1c1
Sequence:CCGGCCGGGCATAGTGGTTGGAGTTCTCGAGAACTCCAACCACTATGCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032857.2-1687s21c1
Sequence:CCGGCCTTAACACCATAGGTGCAAACTCGAGTTTGCACCTATGGTGTTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-1398s21c1
Sequence:CCGGTTGGGATAAAGAGGGTAAATACTCGAGTATTTACCCTCTTTATCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-1465s21c1
Sequence:CCGGTGTAGAAAGCAACGGCATTATCTCGAGATAATGCCGTTGCTTTCTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032857.2-1545s21c1
Sequence:CCGGACTGGATACAGAGACTATAAACTCGAGTTTATAGTCTCTGTATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032857
VALIDATED
LACTB MISSION shRNA shRNA Plasmid DNA
lactamase, beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-577s21c1
Sequence:CCGGGCAGGGAAACTGGATCTTGATCTCGAGATCAAGATCCAGTTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032857.2-577s1c1
Sequence:CCGGGCAGGGAAACTGGATCTTGATCTCGAGATCAAGATCCAGTTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032857.2-1344s1c1
Sequence:CCGGCAAACCAGAAACAATGGTTATCTCGAGATAACCATTGTTTCTGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-1640s1c1
Sequence:CCGGCTTTGAAGATTGCCCTTGAATCTCGAGATTCAAGGGCAATCTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-1198s1c1
Sequence:CCGGCCTTACGTGGATAACTCCTATCTCGAGATAGGAGTTATCCACGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-412s1c1
Sequence:CCGGCCGGGCATAGTGGTTGGAGTTCTCGAGAACTCCAACCACTATGCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032857.2-1687s21c1
Sequence:CCGGCCTTAACACCATAGGTGCAAACTCGAGTTTGCACCTATGGTGTTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-1398s21c1
Sequence:CCGGTTGGGATAAAGAGGGTAAATACTCGAGTATTTACCCTCTTTATCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-1465s21c1
Sequence:CCGGTGTAGAAAGCAACGGCATTATCTCGAGATAATGCCGTTGCTTTCTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032857.2-1545s21c1
Sequence:CCGGACTGGATACAGAGACTATAAACTCGAGTTTATAGTCTCTGTATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032857
VALIDATED
LACTB MISSION shRNA Lentiviral Transduction Particles
lactamase, beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-577s21c1
Sequence:CCGGGCAGGGAAACTGGATCTTGATCTCGAGATCAAGATCCAGTTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_032857.2-577s1c1
Sequence:CCGGGCAGGGAAACTGGATCTTGATCTCGAGATCAAGATCCAGTTTCCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032857.2-1344s1c1
Sequence:CCGGCAAACCAGAAACAATGGTTATCTCGAGATAACCATTGTTTCTGGTTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-1640s1c1
Sequence:CCGGCTTTGAAGATTGCCCTTGAATCTCGAGATTCAAGGGCAATCTTCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-1198s1c1
Sequence:CCGGCCTTACGTGGATAACTCCTATCTCGAGATAGGAGTTATCCACGTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032857.2-412s1c1
Sequence:CCGGCCGGGCATAGTGGTTGGAGTTCTCGAGAACTCCAACCACTATGCCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296726    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032857.2-1687s21c1
Sequence:CCGGCCTTAACACCATAGGTGCAAACTCGAGTTTGCACCTATGGTGTTAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-1398s21c1
Sequence:CCGGTTGGGATAAAGAGGGTAAATACTCGAGTATTTACCCTCTTTATCCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_032857.2-1465s21c1
Sequence:CCGGTGTAGAAAGCAACGGCATTATCTCGAGATAATGCCGTTGCTTTCTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032857.2-1545s21c1
Sequence:CCGGACTGGATACAGAGACTATAAACTCGAGTTTATAGTCTCTGTATCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030717
VALIDATED
LACTB MISSION shRNA Bacterial Glycerol Stock
lactamase, beta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-707s1c1
Sequence:CCGGCTGTCACAACAAGATTACTAACTCGAGTTAGTAATCTTGTTGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1842s1c1
Sequence:CCGGCCCAAATACATAAACCCTTTACTCGAGTAAAGGGTTTATGTATTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1705s1c1
Sequence:CCGGGCTTTGAAGATCGCTCTGGAACTCGAGTTCCAGAGCGATCTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1355s1c1
Sequence:CCGGGCTACCAAGTTGGGCAGTTTACTCGAGTAAACTGCCCAACTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1613s21c1
Sequence:CCGGTGGACTCAGAGGCCGTAAATACTCGAGTATTTACGGCCTCTGAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1413s1c1
Sequence:CCGGGCCAGAAACAATGGTGATGATCTCGAGATCATCACCATTGTTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030717.1-1798s21c1
Sequence:CCGGTTGACGTTCCCAAATACATAACTCGAGTTATGTATTTGGGAACGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1267s21c1
Sequence:CCGGTACGTGGATAACTCCTATAAACTCGAGTTTATAGGAGTTATCCACGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-707s21c1
Sequence:CCGGCTGTCACAACAAGATTACTAACTCGAGTTAGTAATCTTGTTGTGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1705s21c1
Sequence:CCGGGCTTTGAAGATCGCTCTGGAACTCGAGTTCCAGAGCGATCTTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030717
VALIDATED
LACTB MISSION shRNA shRNA Plasmid DNA
lactamase, beta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-707s1c1
Sequence:CCGGCTGTCACAACAAGATTACTAACTCGAGTTAGTAATCTTGTTGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1842s1c1
Sequence:CCGGCCCAAATACATAAACCCTTTACTCGAGTAAAGGGTTTATGTATTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1705s1c1
Sequence:CCGGGCTTTGAAGATCGCTCTGGAACTCGAGTTCCAGAGCGATCTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1355s1c1
Sequence:CCGGGCTACCAAGTTGGGCAGTTTACTCGAGTAAACTGCCCAACTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1613s21c1
Sequence:CCGGTGGACTCAGAGGCCGTAAATACTCGAGTATTTACGGCCTCTGAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1413s1c1
Sequence:CCGGGCCAGAAACAATGGTGATGATCTCGAGATCATCACCATTGTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030717.1-1798s21c1
Sequence:CCGGTTGACGTTCCCAAATACATAACTCGAGTTATGTATTTGGGAACGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1267s21c1
Sequence:CCGGTACGTGGATAACTCCTATAAACTCGAGTTTATAGGAGTTATCCACGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-707s21c1
Sequence:CCGGCTGTCACAACAAGATTACTAACTCGAGTTAGTAATCTTGTTGTGACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1705s21c1
Sequence:CCGGGCTTTGAAGATCGCTCTGGAACTCGAGTTCCAGAGCGATCTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030717
VALIDATED
LACTB MISSION shRNA Lentiviral Transduction Particles
lactamase, beta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-707s1c1
Sequence:CCGGCTGTCACAACAAGATTACTAACTCGAGTTAGTAATCTTGTTGTGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1842s1c1
Sequence:CCGGCCCAAATACATAAACCCTTTACTCGAGTAAAGGGTTTATGTATTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1705s1c1
Sequence:CCGGGCTTTGAAGATCGCTCTGGAACTCGAGTTCCAGAGCGATCTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1355s1c1
Sequence:CCGGGCTACCAAGTTGGGCAGTTTACTCGAGTAAACTGCCCAACTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1613s21c1
Sequence:CCGGTGGACTCAGAGGCCGTAAATACTCGAGTATTTACGGCCTCTGAGTCCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030717.1-1413s1c1
Sequence:CCGGGCCAGAAACAATGGTGATGATCTCGAGATCATCACCATTGTTTCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349949    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030717.1-1798s21c1
Sequence:CCGGTTGACGTTCCCAAATACATAACTCGAGTTATGTATTTGGGAACGTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1267s21c1
Sequence:CCGGTACGTGGATAACTCCTATAAACTCGAGTTTATAGGAGTTATCCACGTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-707s21c1
Sequence:CCGGCTGTCACAACAAGATTACTAACTCGAGTTAGTAATCTTGTTGTGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030717.1-1705s21c1
Sequence:CCGGGCTTTGAAGATCGCTCTGGAACTCGAGTTCCAGAGCGATCTTCAAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)