EMAIL THIS PAGE TO A FRIEND

LAD1

ladinin 1

51 Gene Product Result for
Synonyms: LadA
UniProtKB ID: O00515, O95614, Q96GD8
Gene ID:
Human(3898) Summary: The protein encoded by this gene may be an anchoring filament that is a component of basement membranes. It may contribute to the stability of the association of the epithelial layers with the underlying mesenchyme. [provided by RefSeq, Jul 2008]
Mouse(16763) ladinin
Rat(313325) ladinin 1
chicken(421160) ladinin 1
dog(607639) ladinin 1
cow(505686) ladinin 1
cow(618212) ladinin-1-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133664 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133664 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133664 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005558 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005558 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005558 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005558 Rosetta Predictions human pricing
NM_001107942 Rosetta Predictions rat pricing
NM_133664 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005558 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013074 predicted 1316
2 SASI_Hs01_00013075 predicted 1389
3 SASI_Hs01_00013076 predicted 1898
4 SASI_Hs01_00013077 predicted 1806
5 SASI_Hs01_00013078 predicted 1241
6 SASI_Hs01_00013079 predicted 2140
7 SASI_Hs01_00013080 predicted 1866
8 SASI_Hs01_00013081 predicted 2022
9 SASI_Hs02_00339814 predicted 784
10 SASI_Hs02_00339815 predicted 772
11 SASI_Hs01_00013082 predicted 1796
12 SASI_Hs01_00013083 predicted 949
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233805 predicted 1277
2 SASI_Rn02_00233806 predicted 1740
3 SASI_Rn02_00233807 predicted 553
4 SASI_Rn02_00233808 predicted 698
5 SASI_Rn02_00233809 predicted 1602
6 SASI_Rn02_00233810 predicted 684
7 SASI_Rn02_00233811 predicted 246
8 SASI_Rn02_00233812 predicted 1393
9 SASI_Rn02_00233813 predicted 1017
10 SASI_Rn02_00233814 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133664 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114201 predicted 1874
2 SASI_Mm01_00114202 predicted 1568
3 SASI_Mm01_00114203 predicted 1664
4 SASI_Mm01_00114204 predicted 523
5 SASI_Mm02_00338600 predicted 1568
6 SASI_Mm01_00114205 predicted 1773
7 SASI_Mm01_00114208 predicted 1232
8 SASI_Mm01_00114209 predicted 1220
9 SASI_Mm02_00338601 predicted 1220
10 SASI_Mm02_00338602 predicted 501
11 SASI_Mm01_00114206 predicted 1273
12 SASI_Mm01_00114207 predicted 1433
13 SASI_Mm01_00114210 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133664
LAD1 MISSION shRNA Bacterial Glycerol Stock
ladinin 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000189481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133664.2-2186s1c1
Sequence:CCGGCCCGCTGAAGGTACAATGTATCTCGAGATACATTGTACCTTCAGCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-495s21c1
Sequence:CCGGTTCAACCACAGATGATGAATCCTCGAGGATTCATCATCTGTGGTTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1821s21c1
Sequence:CCGGGGTCGTGACATCAAGACTTAACTCGAGTTAAGTCTTGATGTCACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133664.3-2392s21c1
Sequence:CCGGACTGAGTGCTAGACCTATTTACTCGAGTAAATAGGTCTAGCACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133664.3-1821s1c1
Sequence:CCGGGGTCGTGACATCAAGACTTAACTCGAGTTAAGTCTTGATGTCACGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1563s21c1
Sequence:CCGGCAACTCAGAAACACCCTTAACCTCGAGGTTAAGGGTGTTTCTGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133664.2-1562s1c1
Sequence:CCGGGACAACTCAGAAACACCCTTACTCGAGTAAGGGTGTTTCTGAGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1908s21c1
Sequence:CCGGAGTCACCAAGAGGGCTCAATGCTCGAGCATTGAGCCCTCTTGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133664
LAD1 MISSION shRNA shRNA Plasmid DNA
ladinin 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000189481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133664.2-2186s1c1
Sequence:CCGGCCCGCTGAAGGTACAATGTATCTCGAGATACATTGTACCTTCAGCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-495s21c1
Sequence:CCGGTTCAACCACAGATGATGAATCCTCGAGGATTCATCATCTGTGGTTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1821s21c1
Sequence:CCGGGGTCGTGACATCAAGACTTAACTCGAGTTAAGTCTTGATGTCACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133664.3-2392s21c1
Sequence:CCGGACTGAGTGCTAGACCTATTTACTCGAGTAAATAGGTCTAGCACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133664.3-1821s1c1
Sequence:CCGGGGTCGTGACATCAAGACTTAACTCGAGTTAAGTCTTGATGTCACGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1563s21c1
Sequence:CCGGCAACTCAGAAACACCCTTAACCTCGAGGTTAAGGGTGTTTCTGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133664.2-1562s1c1
Sequence:CCGGGACAACTCAGAAACACCCTTACTCGAGTAAGGGTGTTTCTGAGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1908s21c1
Sequence:CCGGAGTCACCAAGAGGGCTCAATGCTCGAGCATTGAGCCCTCTTGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133664
LAD1 MISSION shRNA Lentiviral Transduction Particles
ladinin 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000189481    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133664.2-2186s1c1
Sequence:CCGGCCCGCTGAAGGTACAATGTATCTCGAGATACATTGTACCTTCAGCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-495s21c1
Sequence:CCGGTTCAACCACAGATGATGAATCCTCGAGGATTCATCATCTGTGGTTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1821s21c1
Sequence:CCGGGGTCGTGACATCAAGACTTAACTCGAGTTAAGTCTTGATGTCACGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133664.3-2392s21c1
Sequence:CCGGACTGAGTGCTAGACCTATTTACTCGAGTAAATAGGTCTAGCACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133664.3-1821s1c1
Sequence:CCGGGGTCGTGACATCAAGACTTAACTCGAGTTAAGTCTTGATGTCACGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1563s21c1
Sequence:CCGGCAACTCAGAAACACCCTTAACCTCGAGGTTAAGGGTGTTTCTGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133664.2-1562s1c1
Sequence:CCGGGACAACTCAGAAACACCCTTACTCGAGTAAGGGTGTTTCTGAGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133664.3-1908s21c1
Sequence:CCGGAGTCACCAAGAGGGCTCAATGCTCGAGCATTGAGCCCTCTTGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005558
LAD1 MISSION shRNA Bacterial Glycerol Stock
ladinin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1247s1c1
Sequence:CCGGCCCGTCACACTCCAGGTGAAACTCGAGTTTCACCTGGAGTGTGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1559s1c1
Sequence:CCGGCGCCACCTCTTTGAGAAGGAACTCGAGTTCCTTCTCAAAGAGGTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-857s1c1
Sequence:CCGGGCCTCAGAGAAGACATCTCTACTCGAGTAGAGATGTCTTCTCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1360s1c1
Sequence:CCGGCTTTCGGATGAAACCCAAGAACTCGAGTTCTTGGGTTTCATCCGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005558.3-2389s1c1
Sequence:CCGGGTGTGCAACCACTTACCCTTTCTCGAGAAAGGGTAAGTGGTTGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005558.3-1511s21c1
Sequence:CCGGCTGCCTTGCACTGAGTTATTCCTCGAGGAATAACTCAGTGCAAGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005558.3-1474s21c1
Sequence:CCGGGGCCATACGGAGATCAGAATCCTCGAGGATTCTGATCTCCGTATGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005558.3-1865s21c1
Sequence:CCGGCAGCACCCTTTCCTCTCATTGCTCGAGCAATGAGAGGAAAGGGTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005558
LAD1 MISSION shRNA shRNA Plasmid DNA
ladinin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1247s1c1
Sequence:CCGGCCCGTCACACTCCAGGTGAAACTCGAGTTTCACCTGGAGTGTGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1559s1c1
Sequence:CCGGCGCCACCTCTTTGAGAAGGAACTCGAGTTCCTTCTCAAAGAGGTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-857s1c1
Sequence:CCGGGCCTCAGAGAAGACATCTCTACTCGAGTAGAGATGTCTTCTCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1360s1c1
Sequence:CCGGCTTTCGGATGAAACCCAAGAACTCGAGTTCTTGGGTTTCATCCGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005558.3-2389s1c1
Sequence:CCGGGTGTGCAACCACTTACCCTTTCTCGAGAAAGGGTAAGTGGTTGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005558.3-1511s21c1
Sequence:CCGGCTGCCTTGCACTGAGTTATTCCTCGAGGAATAACTCAGTGCAAGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005558.3-1474s21c1
Sequence:CCGGGGCCATACGGAGATCAGAATCCTCGAGGATTCTGATCTCCGTATGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005558.3-1865s21c1
Sequence:CCGGCAGCACCCTTTCCTCTCATTGCTCGAGCAATGAGAGGAAAGGGTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005558
LAD1 MISSION shRNA Lentiviral Transduction Particles
ladinin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1247s1c1
Sequence:CCGGCCCGTCACACTCCAGGTGAAACTCGAGTTTCACCTGGAGTGTGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1559s1c1
Sequence:CCGGCGCCACCTCTTTGAGAAGGAACTCGAGTTCCTTCTCAAAGAGGTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-857s1c1
Sequence:CCGGGCCTCAGAGAAGACATCTCTACTCGAGTAGAGATGTCTTCTCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005558.3-1360s1c1
Sequence:CCGGCTTTCGGATGAAACCCAAGAACTCGAGTTCTTGGGTTTCATCCGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005558.3-2389s1c1
Sequence:CCGGGTGTGCAACCACTTACCCTTTCTCGAGAAAGGGTAAGTGGTTGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005558.3-1511s21c1
Sequence:CCGGCTGCCTTGCACTGAGTTATTCCTCGAGGAATAACTCAGTGCAAGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005558.3-1474s21c1
Sequence:CCGGGGCCATACGGAGATCAGAATCCTCGAGGATTCTGATCTCCGTATGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005558.3-1865s21c1
Sequence:CCGGCAGCACCCTTTCCTCTCATTGCTCGAGCAATGAGAGGAAAGGGTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)