EMAIL THIS PAGE TO A FRIEND

LAG3

lymphocyte-activation gene 3

85 Gene Product Result for
Synonyms: CD223
UniProtKB ID: P18627, A8K7T9
Gene ID:
Human(3902) Summary: Lymphocyte-activation protein 3 belongs to Ig superfamily and contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. The sequence data, exon/intron organization, and chromosomal localization all indicate a close relationship of LAG3 to CD4. [provided by RefSeq, Jul 2008]
Mouse(16768) lymphocyte-activation gene 3
Rat(297596) lymphocyte-activation gene 3
chicken(418287) lymphocyte-activation gene 3
dog(486720) lymphocyte-activation gene 3
domestic cat(101093114) lymphocyte-activation gene 3
cow(515155) lymphocyte-activation gene 3
Horse(100059998) lymphocyte-activation gene 3
domestic guinea pig(100734775) lymphocyte-activation gene 3
naked mole-rat(101716254) lymphocyte-activation gene 3
sheep(101109350) lymphocyte-activation gene 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006101 MISSION® esiRNA esiRNA targeting human LAG3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002286 Rosetta Predictions human pricing
NM_212513 Rosetta Predictions rat pricing
NM_008479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038633 predicted 1286
2 SASI_Hs01_00038636 predicted 1290
3 SASI_Hs01_00038637 predicted 1619
4 SASI_Hs01_00038638 predicted 1278
5 SASI_Hs02_00333574 predicted 1524
6 SASI_Hs01_00038639 predicted 1332
7 SASI_Hs01_00038640 predicted 996
8 SASI_Hs01_00038641 predicted 1365
9 SASI_Hs01_00038642 predicted 1437
10 SASI_Hs02_00333575 predicted 1011
11 SASI_Hs01_00038634 predicted 1389
12 SASI_Hs01_00038635 predicted 1378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103511 predicted 1350
2 SASI_Rn02_00270517 predicted 1352
3 SASI_Rn01_00103512 predicted 1336
4 SASI_Rn01_00103513 predicted 1158
5 SASI_Rn01_00103514 predicted 396
6 SASI_Rn01_00103515 predicted 272
7 SASI_Rn01_00103516 predicted 1527
8 SASI_Rn01_00103517 predicted 1413
9 SASI_Rn01_00103518 predicted 694
10 SASI_Rn01_00103519 predicted 1491
11 SASI_Rn01_00103510 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077081 predicted 506
2 SASI_Mm02_00313995 predicted 1450
3 SASI_Mm02_00313996 predicted 1753
4 SASI_Mm01_00077082 predicted 1363
5 SASI_Mm01_00077083 predicted 1583
6 SASI_Mm01_00077084 predicted 880
7 SASI_Mm01_00077086 predicted 1355
8 SASI_Mm01_00077087 predicted 1365
9 SASI_Mm01_00077088 predicted 1389
10 SASI_Mm01_00077089 predicted 874
11 SASI_Mm01_00077085 predicted 1642
12 SASI_Mm01_00077090 predicted 1432
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002286
LAG3 MISSION shRNA Bacterial Glycerol Stock
lymphocyte-activation gene 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1451s1c1
Sequence:CCGGCTTTGTGAGGTGACTCCAGTACTCGAGTACTGGAGTCACCTCACAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1105s1c1
Sequence:CCGGCATCATGTATAACCTCACTGTCTCGAGACAGTGAGGTTATACATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1096s1c1
Sequence:CCGGCAACGTCTCCATCATGTATAACTCGAGTTATACATGATGGAGACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002286.4-1099s1c1
Sequence:CCGGCGTCTCCATCATGTATAACCTCTCGAGAGGTTATACATGATGGAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1348s1c1
Sequence:CCGGCCATATCCATCTGCAGGAACACTCGAGTGTTCCTGCAGATGGATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002286.4-1460s1c1
Sequence:CCGGGTGACTCCAGTATCTGGACAACTCGAGTTGTCCAGATACTGGAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1278s1c1
Sequence:CCGGCTGGAGACAATGGCGACTTTACTCGAGTAAAGTCGCCATTGTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002286.5-503s21c1
Sequence:CCGGGATCTCAGCCTTCTGCGAAGACTCGAGTCTTCGCAGAAGGCTGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002286.5-1000s21c1
Sequence:CCGGCCATCACCACTTAGCGGAAAGCTCGAGCTTTCCGCTAAGTGGTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002286
LAG3 MISSION shRNA shRNA Plasmid DNA
lymphocyte-activation gene 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1451s1c1
Sequence:CCGGCTTTGTGAGGTGACTCCAGTACTCGAGTACTGGAGTCACCTCACAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1105s1c1
Sequence:CCGGCATCATGTATAACCTCACTGTCTCGAGACAGTGAGGTTATACATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1096s1c1
Sequence:CCGGCAACGTCTCCATCATGTATAACTCGAGTTATACATGATGGAGACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002286.4-1099s1c1
Sequence:CCGGCGTCTCCATCATGTATAACCTCTCGAGAGGTTATACATGATGGAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1348s1c1
Sequence:CCGGCCATATCCATCTGCAGGAACACTCGAGTGTTCCTGCAGATGGATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002286.4-1460s1c1
Sequence:CCGGGTGACTCCAGTATCTGGACAACTCGAGTTGTCCAGATACTGGAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1278s1c1
Sequence:CCGGCTGGAGACAATGGCGACTTTACTCGAGTAAAGTCGCCATTGTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002286.5-503s21c1
Sequence:CCGGGATCTCAGCCTTCTGCGAAGACTCGAGTCTTCGCAGAAGGCTGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002286.5-1000s21c1
Sequence:CCGGCCATCACCACTTAGCGGAAAGCTCGAGCTTTCCGCTAAGTGGTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002286
LAG3 MISSION shRNA Lentiviral Transduction Particles
lymphocyte-activation gene 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1451s1c1
Sequence:CCGGCTTTGTGAGGTGACTCCAGTACTCGAGTACTGGAGTCACCTCACAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1105s1c1
Sequence:CCGGCATCATGTATAACCTCACTGTCTCGAGACAGTGAGGTTATACATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1096s1c1
Sequence:CCGGCAACGTCTCCATCATGTATAACTCGAGTTATACATGATGGAGACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002286.4-1099s1c1
Sequence:CCGGCGTCTCCATCATGTATAACCTCTCGAGAGGTTATACATGATGGAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1348s1c1
Sequence:CCGGCCATATCCATCTGCAGGAACACTCGAGTGTTCCTGCAGATGGATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002286.4-1460s1c1
Sequence:CCGGGTGACTCCAGTATCTGGACAACTCGAGTTGTCCAGATACTGGAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002286.4-1278s1c1
Sequence:CCGGCTGGAGACAATGGCGACTTTACTCGAGTAAAGTCGCCATTGTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002286.5-503s21c1
Sequence:CCGGGATCTCAGCCTTCTGCGAAGACTCGAGTCTTCGCAGAAGGCTGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002286.5-1000s21c1
Sequence:CCGGCCATCACCACTTAGCGGAAAGCTCGAGCTTTCCGCTAAGTGGTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008479
LAG3 MISSION shRNA Bacterial Glycerol Stock
lymphocyte-activation gene 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-501s1c1
Sequence:CCGGCCCAACCTGGATCCTAACTTTCTCGAGAAAGTTAGGATCCAGGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-976s1c1
Sequence:CCGGTCTACAACTCACCGCGTCATTCTCGAGAATGACGCGGTGAGTTGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1791s1c1
Sequence:CCGGGAACATGGGATTCAGCCATTTCTCGAGAAATGGCTGAATCCCATGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1085s1c1
Sequence:CCGGCAATGTCTCCATCACGTACAACTCGAGTTGTACGTGATGGAGACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1398s1c1
Sequence:CCGGACTCCCAAATCCTTCGGGTTACTCGAGTAACCCGAAGGATTTGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-533s21c1
Sequence:CCGGGGGTTATCTGGCAACATCAACCTCGAGGTTGATGTTGCCAGATAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-1665s21c1
Sequence:CCGGTAAAGGAGGCCATCTCGTTCTCTCGAGAGAACGAGATGGCCTCCTTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-1145s21c1
Sequence:CCGGTGTACGCTGCTGAAGGTTCTACTCGAGTAGAACCTTCAGCAGCGTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008479
LAG3 MISSION shRNA shRNA Plasmid DNA
lymphocyte-activation gene 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-501s1c1
Sequence:CCGGCCCAACCTGGATCCTAACTTTCTCGAGAAAGTTAGGATCCAGGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-976s1c1
Sequence:CCGGTCTACAACTCACCGCGTCATTCTCGAGAATGACGCGGTGAGTTGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1791s1c1
Sequence:CCGGGAACATGGGATTCAGCCATTTCTCGAGAAATGGCTGAATCCCATGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1085s1c1
Sequence:CCGGCAATGTCTCCATCACGTACAACTCGAGTTGTACGTGATGGAGACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1398s1c1
Sequence:CCGGACTCCCAAATCCTTCGGGTTACTCGAGTAACCCGAAGGATTTGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-533s21c1
Sequence:CCGGGGGTTATCTGGCAACATCAACCTCGAGGTTGATGTTGCCAGATAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-1665s21c1
Sequence:CCGGTAAAGGAGGCCATCTCGTTCTCTCGAGAGAACGAGATGGCCTCCTTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000446491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-1145s21c1
Sequence:CCGGTGTACGCTGCTGAAGGTTCTACTCGAGTAGAACCTTCAGCAGCGTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008479
LAG3 MISSION shRNA Lentiviral Transduction Particles
lymphocyte-activation gene 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-501s1c1
Sequence:CCGGCCCAACCTGGATCCTAACTTTCTCGAGAAAGTTAGGATCCAGGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-976s1c1
Sequence:CCGGTCTACAACTCACCGCGTCATTCTCGAGAATGACGCGGTGAGTTGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1791s1c1
Sequence:CCGGGAACATGGGATTCAGCCATTTCTCGAGAAATGGCTGAATCCCATGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1085s1c1
Sequence:CCGGCAATGTCTCCATCACGTACAACTCGAGTTGTACGTGATGGAGACATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008479.1-1398s1c1
Sequence:CCGGACTCCCAAATCCTTCGGGTTACTCGAGTAACCCGAAGGATTTGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-533s21c1
Sequence:CCGGGGGTTATCTGGCAACATCAACCTCGAGGTTGATGTTGCCAGATAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-1665s21c1
Sequence:CCGGTAAAGGAGGCCATCTCGTTCTCTCGAGAGAACGAGATGGCCTCCTTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000446491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008479.2-1145s21c1
Sequence:CCGGTGTACGCTGCTGAAGGTTCTACTCGAGTAGAACCTTCAGCAGCGTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)