EMAIL THIS PAGE TO A FRIEND

LAGE3

L antigen family, member 3

65 Gene Product Result for
Synonyms: CVG5 DXS9879E DXS9951E ESO3 ITBA2
UniProtKB ID: Q14657, Q5HY39, Q8IZ78
Gene ID:
Human(8270) Summary: This gene belongs to the ESO/LAGE gene family, members of which are clustered together on chromosome Xq28, and have similar exon-intron structures. Unlike the other family members which are normally expressed only in testis and activated in a wide range of human tumors, this gene is ubiquitously expressed in somatic tissues. The latter, combined with the finding that it is highly conserved in mouse and rat, suggests that the encoded protein is functionally important. An intronless pseudogene with high sequence similarity to this gene is located on chromosome 9. [provided by RefSeq, Jul 2008]
Mouse(66192) L antigen family, member 3
Rat(293863) L antigen family, member 3
domestic cat(101092252) L antigen family, member 3
dog(100682856) L antigen family, member 3
sheep(101119118) L antigen family, member 3
domestic guinea pig(100733464) L antigen family, member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006014 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006014 Rosetta Predictions human pricing
NM_001106345 Rosetta Predictions rat pricing
NM_025410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340724 predicted 680
2 SASI_Hs01_00201179 predicted 511
3 SASI_Hs01_00201180 predicted 686
4 SASI_Hs01_00201183 predicted 676
5 SASI_Hs02_00340725 predicted 784
6 SASI_Hs01_00201185 predicted 505
7 SASI_Hs02_00340726 predicted 681
8 SASI_Hs02_00340727 predicted 766
9 SASI_Hs01_00201178 predicted 508
10 SASI_Hs02_00340728 predicted 632
11 SASI_Hs01_00201177 predicted 677
12 SASI_Hs01_00201181 predicted 653
13 SASI_Hs01_00201182 predicted 651
14 SASI_Hs01_00201184 predicted 618
15 SASI_Hs01_00201186 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106345 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218058 predicted 245
2 SASI_Rn02_00218059 predicted 308
3 SASI_Rn02_00218060 predicted 343
4 SASI_Rn02_00218061 predicted 256
5 SASI_Rn02_00218062 predicted 399
6 SASI_Rn02_00218063 predicted 297
7 SASI_Rn02_00218064 predicted 251
8 SASI_Rn02_00218065 predicted 340
9 SASI_Rn02_00218066 predicted 417
10 SASI_Rn02_00218067 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328170 predicted 374
2 SASI_Mm02_00328171 predicted 313
3 SASI_Mm02_00328172 predicted 250
4 SASI_Mm01_00189644 predicted 270
5 SASI_Mm02_00328173 predicted 259
6 SASI_Mm02_00328174 predicted 343
7 SASI_Mm02_00328175 predicted 449
8 SASI_Mm02_00328176 predicted 296
9 SASI_Mm02_00328177 predicted 354
10 SASI_Mm02_00328178 predicted 475
11 SASI_Mm01_00189645 predicted 576
12 SASI_Mm01_00189646 predicted 122
13 SASI_Mm01_00189647 predicted 565
14 SASI_Mm01_00189648 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006014
VALIDATED
LAGE3 MISSION shRNA Bacterial Glycerol Stock
L antigen family, member 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1178s21c1
Sequence:CCGGACTGTAATATACACCACATAACTCGAGTTATGTGGTGTATATTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-942s21c1
Sequence:CCGGTATTCCAAGTCTGAGTTTATTCTCGAGAATAAACTCAGACTTGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1152s21c1
Sequence:CCGGAGTTGCACTTACATAGTAAATCTCGAGATTTACTATGTAAGTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1109s21c1
Sequence:CCGGGATTAACTACTGTCAACATTTCTCGAGAAATGTTGACAGTAGTTAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1086s21c1
Sequence:CCGGATCAATTGGGTTCTGTCATTCCTCGAGGAATGACAGAACCCAATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1052s21c1
Sequence:CCGGTTGAAGACAATTTAGGAAATGCTCGAGCATTTCCTAAATTGTCTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006014.2-691s1c1
Sequence:CCGGCGAATTTCCGTCATCAACTTTCTCGAGAAAGTTGATGACGGAAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006014.2-690s1c1
Sequence:CCGGCCGAATTTCCGTCATCAACTTCTCGAGAAGTTGATGACGGAAATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-708s1c1
Sequence:CCGGCTTTCTTGACCAGCTTTCCCTCTCGAGAGGGAAAGCTGGTCAAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-698s1c1
Sequence:CCGGCCGTCATCAACTTTCTTGACCCTCGAGGGTCAAGAAAGTTGATGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-702s1c1
Sequence:CCGGCATCAACTTTCTTGACCAGCTCTCGAGAGCTGGTCAAGAAAGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006014
VALIDATED
LAGE3 MISSION shRNA shRNA Plasmid DNA
L antigen family, member 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1178s21c1
Sequence:CCGGACTGTAATATACACCACATAACTCGAGTTATGTGGTGTATATTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-942s21c1
Sequence:CCGGTATTCCAAGTCTGAGTTTATTCTCGAGAATAAACTCAGACTTGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1152s21c1
Sequence:CCGGAGTTGCACTTACATAGTAAATCTCGAGATTTACTATGTAAGTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1109s21c1
Sequence:CCGGGATTAACTACTGTCAACATTTCTCGAGAAATGTTGACAGTAGTTAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1086s21c1
Sequence:CCGGATCAATTGGGTTCTGTCATTCCTCGAGGAATGACAGAACCCAATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1052s21c1
Sequence:CCGGTTGAAGACAATTTAGGAAATGCTCGAGCATTTCCTAAATTGTCTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006014.2-691s1c1
Sequence:CCGGCGAATTTCCGTCATCAACTTTCTCGAGAAAGTTGATGACGGAAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006014.2-690s1c1
Sequence:CCGGCCGAATTTCCGTCATCAACTTCTCGAGAAGTTGATGACGGAAATTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-708s1c1
Sequence:CCGGCTTTCTTGACCAGCTTTCCCTCTCGAGAGGGAAAGCTGGTCAAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-698s1c1
Sequence:CCGGCCGTCATCAACTTTCTTGACCCTCGAGGGTCAAGAAAGTTGATGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-702s1c1
Sequence:CCGGCATCAACTTTCTTGACCAGCTCTCGAGAGCTGGTCAAGAAAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006014
VALIDATED
LAGE3 MISSION shRNA Lentiviral Transduction Particles
L antigen family, member 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1178s21c1
Sequence:CCGGACTGTAATATACACCACATAACTCGAGTTATGTGGTGTATATTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-942s21c1
Sequence:CCGGTATTCCAAGTCTGAGTTTATTCTCGAGAATAAACTCAGACTTGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1152s21c1
Sequence:CCGGAGTTGCACTTACATAGTAAATCTCGAGATTTACTATGTAAGTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1109s21c1
Sequence:CCGGGATTAACTACTGTCAACATTTCTCGAGAAATGTTGACAGTAGTTAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1086s21c1
Sequence:CCGGATCAATTGGGTTCTGTCATTCCTCGAGGAATGACAGAACCCAATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369444    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006014.3-1052s21c1
Sequence:CCGGTTGAAGACAATTTAGGAAATGCTCGAGCATTTCCTAAATTGTCTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006014.2-691s1c1
Sequence:CCGGCGAATTTCCGTCATCAACTTTCTCGAGAAAGTTGATGACGGAAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179069    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006014.2-690s1c1
Sequence:CCGGCCGAATTTCCGTCATCAACTTCTCGAGAAGTTGATGACGGAAATTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-708s1c1
Sequence:CCGGCTTTCTTGACCAGCTTTCCCTCTCGAGAGGGAAAGCTGGTCAAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-698s1c1
Sequence:CCGGCCGTCATCAACTTTCTTGACCCTCGAGGGTCAAGAAAGTTGATGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006014.2-702s1c1
Sequence:CCGGCATCAACTTTCTTGACCAGCTCTCGAGAGCTGGTCAAGAAAGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025410
VALIDATED
LAGE3 MISSION shRNA Bacterial Glycerol Stock
L antigen family, member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-275s21c1
Sequence:CCGGGGAACCCGACATCACAGATTCCTCGAGGAATCTGTGATGTCGGGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-454s21c1
Sequence:CCGGCCGACTTTCCATCATCAACTTCTCGAGAAGTTGATGATGGAAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025410.2-170s21c1
Sequence:CCGGGCAGGCACAAAGGCAGTTATTCTCGAGAATAACTGCCTTTGTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-575s21c1
Sequence:CCGGCTCCTCCTAAGCAATACAATTCTCGAGAATTGTATTGCTTAGGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-138s21c1
Sequence:CCGGATGGTCAGACTAGCCGCTGTTCTCGAGAACAGCGGCTAGTCTGACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-576s1c1
Sequence:CCGGCTCCTCCTAAGCAATACAATTCTCGAGAATTGTATTGCTTAGGAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-171s1c1
Sequence:CCGGGCAGGCACAAAGGCAGTTATTCTCGAGAATAACTGCCTTTGTGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-455s1c1
Sequence:CCGGCCGACTTTCCATCATCAACTTCTCGAGAAGTTGATGATGGAAAGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025410.1-452s1c1
Sequence:CCGGCCTCCGACTTTCCATCATCAACTCGAGTTGATGATGGAAAGTCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025410
VALIDATED
LAGE3 MISSION shRNA shRNA Plasmid DNA
L antigen family, member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-275s21c1
Sequence:CCGGGGAACCCGACATCACAGATTCCTCGAGGAATCTGTGATGTCGGGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-454s21c1
Sequence:CCGGCCGACTTTCCATCATCAACTTCTCGAGAAGTTGATGATGGAAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025410.2-170s21c1
Sequence:CCGGGCAGGCACAAAGGCAGTTATTCTCGAGAATAACTGCCTTTGTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-575s21c1
Sequence:CCGGCTCCTCCTAAGCAATACAATTCTCGAGAATTGTATTGCTTAGGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-138s21c1
Sequence:CCGGATGGTCAGACTAGCCGCTGTTCTCGAGAACAGCGGCTAGTCTGACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-576s1c1
Sequence:CCGGCTCCTCCTAAGCAATACAATTCTCGAGAATTGTATTGCTTAGGAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-171s1c1
Sequence:CCGGGCAGGCACAAAGGCAGTTATTCTCGAGAATAACTGCCTTTGTGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-455s1c1
Sequence:CCGGCCGACTTTCCATCATCAACTTCTCGAGAAGTTGATGATGGAAAGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025410.1-452s1c1
Sequence:CCGGCCTCCGACTTTCCATCATCAACTCGAGTTGATGATGGAAAGTCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025410
VALIDATED
LAGE3 MISSION shRNA Lentiviral Transduction Particles
L antigen family, member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-275s21c1
Sequence:CCGGGGAACCCGACATCACAGATTCCTCGAGGAATCTGTGATGTCGGGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-454s21c1
Sequence:CCGGCCGACTTTCCATCATCAACTTCTCGAGAAGTTGATGATGGAAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025410.2-170s21c1
Sequence:CCGGGCAGGCACAAAGGCAGTTATTCTCGAGAATAACTGCCTTTGTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-575s21c1
Sequence:CCGGCTCCTCCTAAGCAATACAATTCTCGAGAATTGTATTGCTTAGGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025410.2-138s21c1
Sequence:CCGGATGGTCAGACTAGCCGCTGTTCTCGAGAACAGCGGCTAGTCTGACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113375    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-576s1c1
Sequence:CCGGCTCCTCCTAAGCAATACAATTCTCGAGAATTGTATTGCTTAGGAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-171s1c1
Sequence:CCGGGCAGGCACAAAGGCAGTTATTCTCGAGAATAACTGCCTTTGTGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025410.1-455s1c1
Sequence:CCGGCCGACTTTCCATCATCAACTTCTCGAGAAGTTGATGATGGAAAGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025410.1-452s1c1
Sequence:CCGGCCTCCGACTTTCCATCATCAACTCGAGTTGATGATGGAAAGTCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)