EMAIL THIS PAGE TO A FRIEND

LAIR1

leukocyte-associated immunoglobulin-like receptor 1

75 Gene Product Result for
Synonyms: CD305 LAIR-1
UniProtKB ID: Q6GTX8
Gene ID:
Human(3903) Summary: The protein encoded by this gene is an inhibitory receptor found on peripheral mononuclear cells, including NK cells, T cells, and B cells. Inhibitory receptors regulate the immune response to prevent lysis of cells recognized as self. The gene is a member of both the immunoglobulin superfamily and the leukocyte-associated inhibitory receptor family. The gene maps to a region of 19q13.4 called the leukocyte receptor cluster, which contains at least 29 genes encoding leukocyte-expressed receptors of the immunoglobulin superfamily. [provided by RefSeq, Jul 2008]
Mouse(52855) leukocyte-associated Ig-like receptor 1
Rat(574531) leukocyte-associated immunoglobulin-like receptor 1
domestic guinea pig(101788662) leukocyte-associated immunoglobulin-like receptor 1
naked mole-rat(101721593) leukocyte-associated immunoglobulin-like receptor 1
cow(615295) leukocyte-associated immunoglobulin-like receptor 1
domestic cat(101081847) leukocyte-associated immunoglobulin-like receptor 1
dog(484308) leukocyte-associated immunoglobulin-like receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1553 Human LAIR1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002287 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002287 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002287 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152641 MISSION® esiRNA esiRNA human LAIR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002287 Rosetta Predictions human pricing
NM_021706 Rosetta Predictions human pricing
NM_001029928 Rosetta Predictions rat pricing
NM_001113474 Rosetta Predictions mouse pricing
NM_178611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002287 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085886 predicted 1416
2 SASI_Hs02_00333576 predicted 1452
3 SASI_Hs02_00333577 predicted 979
4 SASI_Hs02_00333578 predicted 1632
5 SASI_Hs01_00085888 predicted 1147
6 SASI_Hs01_00085890 predicted 1336
7 SASI_Hs02_00333579 predicted 1415
8 SASI_Hs01_00085891 predicted 1229
9 SASI_Hs02_00333580 predicted 1327
10 SASI_Hs01_00085893 predicted 1114
11 SASI_Hs01_00085887 predicted 1395
12 SASI_Hs01_00085889 predicted 1491
13 SASI_Hs01_00085892 predicted 1191
14 SASI_Hs01_00085894 predicted 1523
15 SASI_Hs01_00085895 predicted 1388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171939 predicted 1367
2 SASI_Hs02_00355032 predicted 1398
3 SASI_Hs01_00171940 predicted 1335
4 SASI_Hs01_00171941 predicted 1097
5 SASI_Hs01_00171943 predicted 1282
6 SASI_Hs01_00171944 predicted 1174
7 SASI_Hs01_00171945 predicted 1134
8 SASI_Hs01_00171946 predicted 1065
9 SASI_Hs01_00171947 predicted 1465
10 SASI_Hs01_00171948 predicted 1325
11 SASI_Hs01_00171942 predicted 1439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029928 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203505 predicted 279
2 SASI_Rn02_00203506 predicted 422
3 SASI_Rn02_00203507 predicted 273
4 SASI_Rn02_00203508 predicted 444
5 SASI_Rn02_00203509 predicted 462
6 SASI_Rn02_00203510 predicted 455
7 SASI_Rn02_00203511 predicted 287
8 SASI_Rn02_00203512 predicted 424
9 SASI_Rn02_00203513 predicted 267
10 SASI_Rn02_00203514 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307963 predicted 1228
2 SASI_Mm02_00307964 predicted 1367
3 SASI_Mm02_00307965 predicted 1347
4 SASI_Mm02_00307966 predicted 1061
5 SASI_Mm02_00307967 predicted 1129
6 SASI_Mm02_00307968 predicted 1253
7 SASI_Mm02_00307969 predicted 947
8 SASI_Mm02_00307970 predicted 1367
9 SASI_Mm02_00307971 predicted 1298
10 SASI_Mm02_00307972 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157271 predicted 702
2 SASI_Mm01_00157272 predicted 1039
3 SASI_Mm01_00157273 predicted 677
4 SASI_Mm01_00157274 predicted 874
5 SASI_Mm01_00157275 predicted 432
6 SASI_Mm01_00157276 predicted 738
7 SASI_Mm01_00157277 predicted 326
8 SASI_Mm01_00157278 predicted 442
9 SASI_Mm01_00157279 predicted 972
10 SASI_Mm01_00157280 predicted 313
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002287
VALIDATED
LAIR1 MISSION shRNA Bacterial Glycerol Stock
leukocyte-associated immunoglobulin-like receptor 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-615s1c1
Sequence:CCGGCCATCGCCAGAATCAGATAAACTCGAGTTTATCTGATTCTGGCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002287.2-688s1c1
Sequence:CCGGGACCTGGCTGTTGATGTTCTACTCGAGTAGAACATCAACAGCCAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-244s1c1
Sequence:CCGGGAGAGTAGATCCACATACAATCTCGAGATTGTATGTGGATCTACTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-253s1c1
Sequence:CCGGTCCACATACAATGATACTGAACTCGAGTTCAGTATCATTGTATGTGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002287.2-487s1c1
Sequence:CCGGCCGTCGGACAACAGTCACAATCTCGAGATTGTGACTGTTGTCCGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-757s21c1
Sequence:CCGGCAATGAGCATGCACCTGCTTCCTCGAGGAAGCAGGTGCATGCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-630s21c1
Sequence:CCGGCTAAATGGTCTGAGCAGAGTGCTCGAGCACTCTGCTCAGACCATTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002287.3-1604s21c1
Sequence:CCGGCAGAGACTTTGCTGTAATTATCTCGAGATAATTACAGCAAAGTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-784s21c1
Sequence:CCGGCCTGAAAGCTGAGCATCTGTACTCGAGTACAGATGCTCAGCTTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-530s21c1
Sequence:CCGGGTGTCTCAAGCTAGTCCATCTCTCGAGAGATGGACTAGCTTGAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-795s21c1
Sequence:CCGGAGCATCTGTATATTCTCATCGCTCGAGCGATGAGAATATACAGATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-601s21c1
Sequence:CCGGGCCTTATCGCTGCATCTATTACTCGAGTAATAGATGCAGCGATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002287
VALIDATED
LAIR1 MISSION shRNA shRNA Plasmid DNA
leukocyte-associated immunoglobulin-like receptor 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-615s1c1
Sequence:CCGGCCATCGCCAGAATCAGATAAACTCGAGTTTATCTGATTCTGGCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002287.2-688s1c1
Sequence:CCGGGACCTGGCTGTTGATGTTCTACTCGAGTAGAACATCAACAGCCAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-244s1c1
Sequence:CCGGGAGAGTAGATCCACATACAATCTCGAGATTGTATGTGGATCTACTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-253s1c1
Sequence:CCGGTCCACATACAATGATACTGAACTCGAGTTCAGTATCATTGTATGTGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002287.2-487s1c1
Sequence:CCGGCCGTCGGACAACAGTCACAATCTCGAGATTGTGACTGTTGTCCGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-757s21c1
Sequence:CCGGCAATGAGCATGCACCTGCTTCCTCGAGGAAGCAGGTGCATGCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-630s21c1
Sequence:CCGGCTAAATGGTCTGAGCAGAGTGCTCGAGCACTCTGCTCAGACCATTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002287.3-1604s21c1
Sequence:CCGGCAGAGACTTTGCTGTAATTATCTCGAGATAATTACAGCAAAGTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-784s21c1
Sequence:CCGGCCTGAAAGCTGAGCATCTGTACTCGAGTACAGATGCTCAGCTTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-530s21c1
Sequence:CCGGGTGTCTCAAGCTAGTCCATCTCTCGAGAGATGGACTAGCTTGAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-795s21c1
Sequence:CCGGAGCATCTGTATATTCTCATCGCTCGAGCGATGAGAATATACAGATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-601s21c1
Sequence:CCGGGCCTTATCGCTGCATCTATTACTCGAGTAATAGATGCAGCGATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002287
VALIDATED
LAIR1 MISSION shRNA Lentiviral Transduction Particles
leukocyte-associated immunoglobulin-like receptor 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-615s1c1
Sequence:CCGGCCATCGCCAGAATCAGATAAACTCGAGTTTATCTGATTCTGGCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_002287.2-688s1c1
Sequence:CCGGGACCTGGCTGTTGATGTTCTACTCGAGTAGAACATCAACAGCCAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-244s1c1
Sequence:CCGGGAGAGTAGATCCACATACAATCTCGAGATTGTATGTGGATCTACTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002287.2-253s1c1
Sequence:CCGGTCCACATACAATGATACTGAACTCGAGTTCAGTATCATTGTATGTGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_002287.2-487s1c1
Sequence:CCGGCCGTCGGACAACAGTCACAATCTCGAGATTGTGACTGTTGTCCGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-757s21c1
Sequence:CCGGCAATGAGCATGCACCTGCTTCCTCGAGGAAGCAGGTGCATGCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-630s21c1
Sequence:CCGGCTAAATGGTCTGAGCAGAGTGCTCGAGCACTCTGCTCAGACCATTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420408    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002287.3-1604s21c1
Sequence:CCGGCAGAGACTTTGCTGTAATTATCTCGAGATAATTACAGCAAAGTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-784s21c1
Sequence:CCGGCCTGAAAGCTGAGCATCTGTACTCGAGTACAGATGCTCAGCTTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-530s21c1
Sequence:CCGGGTGTCTCAAGCTAGTCCATCTCTCGAGAGATGGACTAGCTTGAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-795s21c1
Sequence:CCGGAGCATCTGTATATTCTCATCGCTCGAGCGATGAGAATATACAGATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002287.3-601s21c1
Sequence:CCGGGCCTTATCGCTGCATCTATTACTCGAGTAATAGATGCAGCGATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178611
LAIR1 MISSION shRNA Bacterial Glycerol Stock
leukocyte-associated immunoglobulin-like receptor 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000099880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178611.2-1708s1c1
Sequence:CCGGGCCTTGTGTATGTATCATGTTCTCGAGAACATGATACATACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-413s1c1
Sequence:CCGGGACCTTCAAGAGGTGACGTATCTCGAGATACGTCACCTCTTGAAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-415s1c1
Sequence:CCGGCCTTCAAGAGGTGACGTATATCTCGAGATATACGTCACCTCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-306s1c1
Sequence:CCGGAGAGGCTAAATCTAGCTACTACTCGAGTAGTAGCTAGATTTAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178611
LAIR1 MISSION shRNA shRNA Plasmid DNA
leukocyte-associated immunoglobulin-like receptor 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000099880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178611.2-1708s1c1
Sequence:CCGGGCCTTGTGTATGTATCATGTTCTCGAGAACATGATACATACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-413s1c1
Sequence:CCGGGACCTTCAAGAGGTGACGTATCTCGAGATACGTCACCTCTTGAAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-415s1c1
Sequence:CCGGCCTTCAAGAGGTGACGTATATCTCGAGATATACGTCACCTCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-306s1c1
Sequence:CCGGAGAGGCTAAATCTAGCTACTACTCGAGTAGTAGCTAGATTTAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178611
LAIR1 MISSION shRNA Lentiviral Transduction Particles
leukocyte-associated immunoglobulin-like receptor 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000099880    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178611.2-1708s1c1
Sequence:CCGGGCCTTGTGTATGTATCATGTTCTCGAGAACATGATACATACACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-413s1c1
Sequence:CCGGGACCTTCAAGAGGTGACGTATCTCGAGATACGTCACCTCTTGAAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-415s1c1
Sequence:CCGGCCTTCAAGAGGTGACGTATATCTCGAGATATACGTCACCTCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178611.2-306s1c1
Sequence:CCGGAGAGGCTAAATCTAGCTACTACTCGAGTAGTAGCTAGATTTAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)