EMAIL THIS PAGE TO A FRIEND

LAIR2

leukocyte-associated immunoglobulin-like receptor 2

27 Gene Product Result for
Synonyms: CD306
Species: Human LAIR2(3904)
UniProtKB ID: Q6ISS4, Q6PEZ4
Gene ID:
Human(3904) Summary: The protein encoded by this gene is a member of the immunoglobulin superfamily. It was identified by its similarity to LAIR1, an inhibitory receptor present on mononuclear leukocytes. This gene maps to a region of 19q13.4, termed the leukocyte receptor cluster, which contains 29 genes in the immunoglobulin superfamily, including LAIR1. The function of this protein is unknown, although it is thought to be secreted and may help modulate mucosal tolerance. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1554 Human LAIR2 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002288 Rosetta Predictions human pricing
NM_021270 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226095 predicted 318
2 SASI_Hs01_00226096 predicted 412
3 SASI_Hs01_00226097 predicted 319
4 SASI_Hs01_00226098 predicted 324
5 SASI_Hs01_00226099 predicted 407
6 SASI_Hs01_00226100 predicted 413
7 SASI_Hs01_00226101 predicted 306
8 SASI_Hs01_00226102 predicted 343
9 SASI_Hs01_00226103 predicted 304
10 SASI_Hs01_00226104 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240216 predicted 318
2 SASI_Hs01_00240217 predicted 302
3 SASI_Hs01_00240218 predicted 307
4 SASI_Hs01_00240219 predicted 290
5 SASI_Hs01_00240220 predicted 306
6 SASI_Hs01_00240221 predicted 293
7 SASI_Hs01_00240222 predicted 295
8 SASI_Hs01_00240223 predicted 310
9 SASI_Hs01_00240224 predicted 508
10 SASI_Hs01_00240225 predicted 406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021270
LAIR2 MISSION shRNA Bacterial Glycerol Stock
leukocyte-associated immunoglobulin-like receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-443s21c1
Sequence:CCGGTGGATGGTCTGAGCACAGTGACTCGAGTCACTGTGCTCAGACCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-347s21c1
Sequence:CCGGTCGACTTGGTCCATCTGAGTCCTCGAGGACTCAGATGGACCAAGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-333s21c1
Sequence:CCGGAGTTATAATGTGTTTCGACTTCTCGAGAAGTCGAAACACATTATAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-508s1c1
Sequence:CCGGCCTCCGGATTTGATGCACCATCTCGAGATGGTGCATCAAATCCGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-196s1c1
Sequence:CCGGCCCTTCCCAGACCCTCCATCTCTCGAGAGATGGAGGGTCTGGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-312s1c1
Sequence:CCGGGATAGAGCCAAGTACAAAGATCTCGAGATCTTTGTACTTGGCTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-376s1c1
Sequence:CCGGGATTCCACATTGACTCAGTAACTCGAGTTACTGAGTCAATGTGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-318s1c1
Sequence:CCGGGCCAAGTACAAAGATAGTTATCTCGAGATAACTATCTTTGTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021270
LAIR2 MISSION shRNA shRNA Plasmid DNA
leukocyte-associated immunoglobulin-like receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-443s21c1
Sequence:CCGGTGGATGGTCTGAGCACAGTGACTCGAGTCACTGTGCTCAGACCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-347s21c1
Sequence:CCGGTCGACTTGGTCCATCTGAGTCCTCGAGGACTCAGATGGACCAAGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-333s21c1
Sequence:CCGGAGTTATAATGTGTTTCGACTTCTCGAGAAGTCGAAACACATTATAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-508s1c1
Sequence:CCGGCCTCCGGATTTGATGCACCATCTCGAGATGGTGCATCAAATCCGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-196s1c1
Sequence:CCGGCCCTTCCCAGACCCTCCATCTCTCGAGAGATGGAGGGTCTGGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-312s1c1
Sequence:CCGGGATAGAGCCAAGTACAAAGATCTCGAGATCTTTGTACTTGGCTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-376s1c1
Sequence:CCGGGATTCCACATTGACTCAGTAACTCGAGTTACTGAGTCAATGTGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-318s1c1
Sequence:CCGGGCCAAGTACAAAGATAGTTATCTCGAGATAACTATCTTTGTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021270
LAIR2 MISSION shRNA Lentiviral Transduction Particles
leukocyte-associated immunoglobulin-like receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-443s21c1
Sequence:CCGGTGGATGGTCTGAGCACAGTGACTCGAGTCACTGTGCTCAGACCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-347s21c1
Sequence:CCGGTCGACTTGGTCCATCTGAGTCCTCGAGGACTCAGATGGACCAAGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021270.2-333s21c1
Sequence:CCGGAGTTATAATGTGTTTCGACTTCTCGAGAAGTCGAAACACATTATAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-508s1c1
Sequence:CCGGCCTCCGGATTTGATGCACCATCTCGAGATGGTGCATCAAATCCGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-196s1c1
Sequence:CCGGCCCTTCCCAGACCCTCCATCTCTCGAGAGATGGAGGGTCTGGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-312s1c1
Sequence:CCGGGATAGAGCCAAGTACAAAGATCTCGAGATCTTTGTACTTGGCTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-376s1c1
Sequence:CCGGGATTCCACATTGACTCAGTAACTCGAGTTACTGAGTCAATGTGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021270.2-318s1c1
Sequence:CCGGGCCAAGTACAAAGATAGTTATCTCGAGATAACTATCTTTGTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)