EMAIL THIS PAGE TO A FRIEND

LALBA

lactalbumin, alpha-

102 Gene Product Result for
UniProtKB ID: P00709, Q6FGX0, Q9UDK4
Gene ID:
Human(3906) Summary: This gene encodes alpha-lactalbumin, a principal protein of milk. Alpha-lactalbumin forms the regulatory subunit of the lactose synthase (LS) heterodimer and beta 1,4-galactosyltransferase (beta4Gal-T1) forms the catalytic component. Together, these proteins enable LS to produce lactose by transfering galactose moieties to glucose. As a monomer, alpha-lactalbumin strongly binds calcium and zinc ions and may possess bactericidal or antitumor activity. A folding variant of alpha-lactalbumin, called HAMLET, likely induces apoptosis in tumor and immature cells. [provided by RefSeq, Jul 2008]
Mouse(16770) lactalbumin, alpha
Rat(24528) lactalbumin, alpha
cow(281894) lactalbumin, alpha-
domestic cat(101090027) lactalbumin, alpha-
dog(403730) lactalbumin, alpha-
domestic guinea pig(100379577) lactalbumin, alpha
naked mole-rat(101701591) lactalbumin, alpha-
Goat(100860779) lactalbumin, alpha-
Domestic Rabbit(100008717) lactalbumin, alpha-
sheep(443386) lactalbumin, alpha-
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002289 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002289 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002289 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010679 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010679 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010679 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003951 MISSION® esiRNA esiRNA targeting mouse Lalba (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002289 Rosetta Predictions human pricing
NM_012594 Rosetta Predictions rat pricing
NM_010679 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153780 predicted 489
2 SASI_Hs01_00153781 predicted 356
3 SASI_Hs01_00153782 predicted 222
4 SASI_Hs01_00153783 predicted 411
5 SASI_Hs01_00153784 predicted 392
6 SASI_Hs01_00153785 predicted 347
7 SASI_Hs01_00153786 predicted 493
8 SASI_Hs01_00153787 predicted 477
9 SASI_Hs02_00333581 predicted 293
10 SASI_Hs02_00333582 predicted 442
11 SASI_Hs01_00153778 predicted 341
12 SASI_Hs01_00153779 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012594 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052760 predicted 211
2 SASI_Rn01_00052761 predicted 221
3 SASI_Rn01_00052762 predicted 202
4 SASI_Rn01_00052763 predicted 205
5 SASI_Rn01_00052764 predicted 194
6 SASI_Rn02_00259742 predicted 194
7 SASI_Rn01_00052765 predicted 220
8 SASI_Rn01_00052766 predicted 222
9 SASI_Rn01_00052767 predicted 204
10 SASI_Rn01_00052768 predicted 254
11 SASI_Rn01_00052769 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010679 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141619 predicted 205
2 SASI_Mm01_00141620 predicted 221
3 SASI_Mm01_00141621 predicted 216
4 SASI_Mm01_00141622 predicted 208
5 SASI_Mm01_00141623 predicted 212
6 SASI_Mm01_00141624 predicted 207
7 SASI_Mm01_00141625 predicted 212
8 SASI_Mm01_00141626 predicted 219
9 SASI_Mm02_00319116 predicted 206
10 SASI_Mm02_00319117 predicted 205
11 SASI_Mm01_00141627 predicted 363
12 SASI_Mm01_00141628 predicted 276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002289
LALBA MISSION shRNA Bacterial Glycerol Stock
lactalbumin, alpha-
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-357s1c1
Sequence:CCGGGCCAAGAAGATCCTGGATATTCTCGAGAATATCCAGGATCTTCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-169s1c1
Sequence:CCGGCCATGTTTCACACCAGTGGTTCTCGAGAACCACTGGTGTGAAACATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-287s1c1
Sequence:CCGGGTCAAGGAACATCTGTGACATCTCGAGATGTCACAGATGTTCCTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-152s1c1
Sequence:CCGGGCCTGAATTGATCTGTACCATCTCGAGATGGTACAGATCAATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-116s1c1
Sequence:CCGGGCTGAAAGACATAGATGGTTACTCGAGTAACCATCTATGTCTTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002289.2-496s21c1
Sequence:CCGGTGGAATACCTCTTCCCTAATGCTCGAGCATTAGGGAAGAGGTATTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002289.2-214s21c1
Sequence:CCGGACAATGAAAGCACGGAATATGCTCGAGCATATTCCGTGCTTTCATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002289.2-236s21c1
Sequence:CCGGACTCTTCCAGATCAGTAATAACTCGAGTTATTACTGATCTGGAAGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002289
LALBA MISSION shRNA shRNA Plasmid DNA
lactalbumin, alpha-
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-357s1c1
Sequence:CCGGGCCAAGAAGATCCTGGATATTCTCGAGAATATCCAGGATCTTCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-169s1c1
Sequence:CCGGCCATGTTTCACACCAGTGGTTCTCGAGAACCACTGGTGTGAAACATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-287s1c1
Sequence:CCGGGTCAAGGAACATCTGTGACATCTCGAGATGTCACAGATGTTCCTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-152s1c1
Sequence:CCGGGCCTGAATTGATCTGTACCATCTCGAGATGGTACAGATCAATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-116s1c1
Sequence:CCGGGCTGAAAGACATAGATGGTTACTCGAGTAACCATCTATGTCTTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002289.2-496s21c1
Sequence:CCGGTGGAATACCTCTTCCCTAATGCTCGAGCATTAGGGAAGAGGTATTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002289.2-214s21c1
Sequence:CCGGACAATGAAAGCACGGAATATGCTCGAGCATATTCCGTGCTTTCATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002289.2-236s21c1
Sequence:CCGGACTCTTCCAGATCAGTAATAACTCGAGTTATTACTGATCTGGAAGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002289
LALBA MISSION shRNA Lentiviral Transduction Particles
lactalbumin, alpha-
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-357s1c1
Sequence:CCGGGCCAAGAAGATCCTGGATATTCTCGAGAATATCCAGGATCTTCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-169s1c1
Sequence:CCGGCCATGTTTCACACCAGTGGTTCTCGAGAACCACTGGTGTGAAACATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-287s1c1
Sequence:CCGGGTCAAGGAACATCTGTGACATCTCGAGATGTCACAGATGTTCCTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-152s1c1
Sequence:CCGGGCCTGAATTGATCTGTACCATCTCGAGATGGTACAGATCAATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002289.1-116s1c1
Sequence:CCGGGCTGAAAGACATAGATGGTTACTCGAGTAACCATCTATGTCTTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002289.2-496s21c1
Sequence:CCGGTGGAATACCTCTTCCCTAATGCTCGAGCATTAGGGAAGAGGTATTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002289.2-214s21c1
Sequence:CCGGACAATGAAAGCACGGAATATGCTCGAGCATATTCCGTGCTTTCATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002289.2-236s21c1
Sequence:CCGGACTCTTCCAGATCAGTAATAACTCGAGTTATTACTGATCTGGAAGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010679
LALBA MISSION shRNA Bacterial Glycerol Stock
lactalbumin, alpha-
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-118s1c1
Sequence:CCGGGATGGCTATCAAGGCATCTCTCTCGAGAGAGATGCCTTGATAGCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-293s1c1
Sequence:CCGGGCATCTCCTGTGACAAGTTATCTCGAGATAACTTGTCACAGGAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-348s1c1
Sequence:CCGGCAAGAAGATCCTGGCTATCAACTCGAGTTGATAGCCAGGATCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-366s1c1
Sequence:CCGGCAAAGGAATCGACTACTGGAACTCGAGTTCCAGTAGTCGATTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010679.1-549s21c1
Sequence:CCGGGATCTGCCTCTGAGCCTTGTACTCGAGTACAAGGCTCAGAGGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010679.1-533s21c1
Sequence:CCGGCTATTCCTGTGAAGATGATCTCTCGAGAGATCATCTTCACAGGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010679.1-413s21c1
Sequence:CCGGAGCTTGAACAGTGGCGTTGTGCTCGAGCACAACGCCACTGTTCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010679
LALBA MISSION shRNA shRNA Plasmid DNA
lactalbumin, alpha-
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-118s1c1
Sequence:CCGGGATGGCTATCAAGGCATCTCTCTCGAGAGAGATGCCTTGATAGCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-293s1c1
Sequence:CCGGGCATCTCCTGTGACAAGTTATCTCGAGATAACTTGTCACAGGAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-348s1c1
Sequence:CCGGCAAGAAGATCCTGGCTATCAACTCGAGTTGATAGCCAGGATCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-366s1c1
Sequence:CCGGCAAAGGAATCGACTACTGGAACTCGAGTTCCAGTAGTCGATTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010679.1-549s21c1
Sequence:CCGGGATCTGCCTCTGAGCCTTGTACTCGAGTACAAGGCTCAGAGGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010679.1-533s21c1
Sequence:CCGGCTATTCCTGTGAAGATGATCTCTCGAGAGATCATCTTCACAGGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010679.1-413s21c1
Sequence:CCGGAGCTTGAACAGTGGCGTTGTGCTCGAGCACAACGCCACTGTTCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010679
LALBA MISSION shRNA Lentiviral Transduction Particles
lactalbumin, alpha-
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-118s1c1
Sequence:CCGGGATGGCTATCAAGGCATCTCTCTCGAGAGAGATGCCTTGATAGCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-293s1c1
Sequence:CCGGGCATCTCCTGTGACAAGTTATCTCGAGATAACTTGTCACAGGAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-348s1c1
Sequence:CCGGCAAGAAGATCCTGGCTATCAACTCGAGTTGATAGCCAGGATCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010679.1-366s1c1
Sequence:CCGGCAAAGGAATCGACTACTGGAACTCGAGTTCCAGTAGTCGATTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010679.1-549s21c1
Sequence:CCGGGATCTGCCTCTGAGCCTTGTACTCGAGTACAAGGCTCAGAGGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443142    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010679.1-533s21c1
Sequence:CCGGCTATTCCTGTGAAGATGATCTCTCGAGAGATCATCTTCACAGGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010679.1-413s21c1
Sequence:CCGGAGCTTGAACAGTGGCGTTGTGCTCGAGCACAACGCCACTGTTCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)