EMAIL THIS PAGE TO A FRIEND

LAMA2

laminin, alpha 2

91 Gene Product Result for
Synonyms: LAMM
UniProtKB ID: P24043, Q14736, Q5VUM2, Q93022
Gene ID:
Human(3908) Summary: Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16773) laminin, alpha 2
Rat(309368) laminin, alpha 2
naked mole-rat(101725515) laminin, alpha 2
sheep(101117424) laminin, alpha 2
Domestic Rabbit(100350500) laminin, alpha 2
Zebrafish(100049705) laminin, alpha 2
dog(484121) laminin, alpha 2
cow(100138434) laminin, alpha 2
Horse(100073067) laminin, alpha 2
domestic cat(101092612) laminin, alpha 2
dog(100683420) laminin, alpha 2
chicken(421709) laminin, alpha 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000426 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000426 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000426 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000426 Rosetta Predictions human pricing
NM_001079823 Rosetta Predictions human pricing
XM_001062273 Rosetta Predictions rat pricing
XM_219866 Rosetta Predictions rat pricing
NM_008481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000426 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302531 predicted 3828
2 SASI_Hs01_00053198 predicted 6776
3 SASI_Hs01_00053199 predicted 6445
4 SASI_Hs01_00053201 predicted 8048
5 SASI_Hs01_00053202 predicted 9202
6 SASI_Hs01_00053203 predicted 4954
7 SASI_Hs02_00302532 predicted 3171
8 SASI_Hs02_00302533 predicted 1352
9 SASI_Hs01_00053207 predicted 6494
10 SASI_Hs02_00302534 predicted 2922
11 SASI_Hs01_00053200 predicted 7678
12 SASI_Hs01_00053204 predicted 8100
13 SASI_Hs01_00053205 predicted 8598
14 SASI_Hs01_00053206 predicted 4347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313830 predicted 3829
2 SASI_Hs02_00313831 predicted 6780
3 SASI_Hs02_00313832 predicted 6439
4 SASI_Hs02_00313833 predicted 8038
5 SASI_Hs02_00313834 predicted 9195
6 SASI_Hs02_00313835 predicted 4950
7 SASI_Hs02_00313836 predicted 3169
8 SASI_Hs02_00313837 predicted 1356
9 SASI_Hs02_00313838 predicted 6503
10 SASI_Hs02_00313839 predicted 2927
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302906 predicted 2038
2 SASI_Rn02_00302907 predicted 6802
3 SASI_Rn02_00302908 predicted 8840
4 SASI_Rn02_00302909 predicted 3477
5 SASI_Rn02_00302910 predicted 737
6 SASI_Rn02_00302911 predicted 3498
7 SASI_Rn02_00302912 predicted 2866
8 SASI_Rn02_00302913 predicted 7015
9 SASI_Rn02_00302914 predicted 1720
10 SASI_Rn02_00302915 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378789 predicted 2039
2 SASI_Rn02_00378790 predicted 6801
3 SASI_Rn02_00378791 predicted 8847
4 SASI_Rn02_00378792 predicted 3476
5 SASI_Rn02_00378793 predicted 742
6 SASI_Rn02_00378794 predicted 3494
7 SASI_Rn02_00378795 predicted 2865
8 SASI_Rn02_00378796 predicted 7016
9 SASI_Rn02_00378797 predicted 1725
10 SASI_Rn02_00378798 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180554 predicted 2612
2 SASI_Mm02_00313998 predicted 9008
3 SASI_Mm01_00180555 predicted 5581
4 SASI_Mm01_00180556 predicted 6523
5 SASI_Mm01_00180557 predicted 2040
6 SASI_Mm01_00180559 predicted 7396
7 SASI_Mm02_00313999 predicted 4423
8 SASI_Mm01_00180560 predicted 3497
9 SASI_Mm01_00180561 predicted 6808
10 SASI_Mm02_00314000 predicted 7497
11 SASI_Mm01_00180558 predicted 5601
12 SASI_Mm01_00180562 predicted 5567
13 SASI_Mm01_00180563 predicted 7777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008481
LAMA2 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-139s1c1
Sequence:CCGGGCGCATCAACAGAGAGGTTTACTCGAGTAAACCTCTCTGTTGATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-5566s1c1
Sequence:CCGGGCCAATCAACTCTTAGGTGAACTCGAGTTCACCTAAGAGTTGATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-2470s1c1
Sequence:CCGGCCACTCAATATCCCATCAAATCTCGAGATTTGATGGGATATTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-845s1c1
Sequence:CCGGCCATTGTCACACGAAGATATTCTCGAGAATATCTTCGTGTGACAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-1951s1c1
Sequence:CCGGGCGTATAAGGAGGTGTACTTACTCGAGTAAGTACACCTCCTTATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-6003s21c1
Sequence:CCGGACAAGTCCTCAGGGCTTATTACTCGAGTAATAAGCCCTGAGGACTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-1212s21c1
Sequence:CCAGGCTAGCAGAAATCTAAGTTTACTCGAGTAAACTTAGATTTCTGCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-5692s21c1
Sequence:CCGGTAGATTATGTCGACGACATTACTCGAGTAATGTCGTCGACATAATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008481
LAMA2 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-139s1c1
Sequence:CCGGGCGCATCAACAGAGAGGTTTACTCGAGTAAACCTCTCTGTTGATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-5566s1c1
Sequence:CCGGGCCAATCAACTCTTAGGTGAACTCGAGTTCACCTAAGAGTTGATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-2470s1c1
Sequence:CCGGCCACTCAATATCCCATCAAATCTCGAGATTTGATGGGATATTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-845s1c1
Sequence:CCGGCCATTGTCACACGAAGATATTCTCGAGAATATCTTCGTGTGACAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-1951s1c1
Sequence:CCGGGCGTATAAGGAGGTGTACTTACTCGAGTAAGTACACCTCCTTATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-6003s21c1
Sequence:CCGGACAAGTCCTCAGGGCTTATTACTCGAGTAATAAGCCCTGAGGACTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-1212s21c1
Sequence:CCAGGCTAGCAGAAATCTAAGTTTACTCGAGTAAACTTAGATTTCTGCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-5692s21c1
Sequence:CCGGTAGATTATGTCGACGACATTACTCGAGTAATGTCGTCGACATAATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008481
LAMA2 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-139s1c1
Sequence:CCGGGCGCATCAACAGAGAGGTTTACTCGAGTAAACCTCTCTGTTGATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-5566s1c1
Sequence:CCGGGCCAATCAACTCTTAGGTGAACTCGAGTTCACCTAAGAGTTGATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-2470s1c1
Sequence:CCGGCCACTCAATATCCCATCAAATCTCGAGATTTGATGGGATATTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-845s1c1
Sequence:CCGGCCATTGTCACACGAAGATATTCTCGAGAATATCTTCGTGTGACAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008481.1-1951s1c1
Sequence:CCGGGCGTATAAGGAGGTGTACTTACTCGAGTAAGTACACCTCCTTATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-6003s21c1
Sequence:CCGGACAAGTCCTCAGGGCTTATTACTCGAGTAATAAGCCCTGAGGACTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-1212s21c1
Sequence:CCAGGCTAGCAGAAATCTAAGTTTACTCGAGTAAACTTAGATTTCTGCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425300    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008481.2-5692s21c1
Sequence:CCGGTAGATTATGTCGACGACATTACTCGAGTAATGTCGTCGACATAATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000426
LAMA2 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-6371s1c1
Sequence:CCGGCGGCTAATAGATAAACTCAAACTCGAGTTTGAGTTTATCTATTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-1811s1c1
Sequence:CCGGGCTCCCTATCTGGGAAACAAACTCGAGTTTGTTTCCCAGATAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-3264s1c1
Sequence:CCGGGCAATGTAAATACAGGCCAATCTCGAGATTGGCCTGTATTTACATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-7530s1c1
Sequence:CCGGGCTGCCTCAAAGATATTGAAACTCGAGTTTCAATATCTTTGAGGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-2477s1c1
Sequence:CCGGCCACTCAATATCCCATCCAATCTCGAGATTGGATGGGATATTGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000426
LAMA2 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-6371s1c1
Sequence:CCGGCGGCTAATAGATAAACTCAAACTCGAGTTTGAGTTTATCTATTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-1811s1c1
Sequence:CCGGGCTCCCTATCTGGGAAACAAACTCGAGTTTGTTTCCCAGATAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-3264s1c1
Sequence:CCGGGCAATGTAAATACAGGCCAATCTCGAGATTGGCCTGTATTTACATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-7530s1c1
Sequence:CCGGGCTGCCTCAAAGATATTGAAACTCGAGTTTCAATATCTTTGAGGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-2477s1c1
Sequence:CCGGCCACTCAATATCCCATCCAATCTCGAGATTGGATGGGATATTGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000426
LAMA2 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-6371s1c1
Sequence:CCGGCGGCTAATAGATAAACTCAAACTCGAGTTTGAGTTTATCTATTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-1811s1c1
Sequence:CCGGGCTCCCTATCTGGGAAACAAACTCGAGTTTGTTTCCCAGATAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-3264s1c1
Sequence:CCGGGCAATGTAAATACAGGCCAATCTCGAGATTGGCCTGTATTTACATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-7530s1c1
Sequence:CCGGGCTGCCTCAAAGATATTGAAACTCGAGTTTCAATATCTTTGAGGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000426.2-2477s1c1
Sequence:CCGGCCACTCAATATCCCATCCAATCTCGAGATTGGATGGGATATTGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)