EMAIL THIS PAGE TO A FRIEND

LAMA3

laminin, alpha 3

103 Gene Product Result for
Synonyms: BM600 E170 LAMNA LOCS lama3a
Gene ID:
Human(3909) Summary: Laminins are basement membrane components thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. The protein encoded by this gene is the alpha-3 subunit of laminin 5, which is a complex glycoprotein composed of three subunits (alpha, beta, and gamma). Laminin 5 is thought to be involved in cell adhesion, signal transduction and differentiation of keratinocytes. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(16774) laminin, alpha 3
Rat(307582) laminin, alpha 3
Zebrafish(100034616) laminin, alpha 3
chicken(428524) laminin, alpha 3
dog(480173) laminin, alpha 3
Horse(791238) laminin, alpha 3
cow(100138045) laminin, alpha 3
cow(100336873) laminin, alpha 3
domestic cat(101100161) laminin, alpha 3
sheep(101120460) laminin, alpha 3
Domestic Rabbit(100346886) laminin, alpha 3
naked mole-rat(101709526) laminin, alpha 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_140451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_140451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_140451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000227 Rosetta Predictions human pricing
NM_001127717 Rosetta Predictions human pricing
NM_001127718 Rosetta Predictions human pricing
NM_198129 Rosetta Predictions human pricing
NM_173306 Rosetta Predictions rat pricing
XM_140451 Rosetta Predictions mouse pricing
XM_981828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140658 predicted 2827
2 SASI_Hs02_00302129 predicted 2743
3 SASI_Hs01_00140659 predicted 2656
4 SASI_Hs01_00140661 predicted 3251
5 SASI_Hs01_00140662 predicted 3426
6 SASI_Hs02_00302130 predicted 795
7 SASI_Hs01_00140663 predicted 2725
8 SASI_Hs01_00140664 predicted 2611
9 SASI_Hs02_00302131 predicted 2702
10 SASI_Hs01_00140665 predicted 1992
11 SASI_Hs01_00140657 predicted 4277
12 SASI_Hs01_00140660 predicted 4088
13 SASI_Hs01_00140666 predicted 2800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127717 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330364 predicted 3242
2 SASI_Hs02_00330365 predicted 7571
3 SASI_Hs02_00330366 predicted 852
4 SASI_Hs02_00330367 predicted 4466
5 SASI_Hs02_00330368 predicted 621
6 SASI_Hs02_00330369 predicted 8171
7 SASI_Hs02_00330370 predicted 7461
8 SASI_Hs02_00330371 predicted 2370
9 SASI_Hs02_00330372 predicted 2611
10 SASI_Hs02_00330373 predicted 5241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127718 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330374 predicted 2685
2 SASI_Hs02_00330375 predicted 2602
3 SASI_Hs02_00330376 predicted 220
4 SASI_Hs02_00330377 predicted 3109
5 SASI_Hs02_00330378 predicted 3275
6 SASI_Hs02_00330379 predicted 2580
7 SASI_Hs02_00330380 predicted 2464
8 SASI_Hs02_00330381 predicted 1851
9 SASI_Hs02_00330382 predicted 357
10 SASI_Hs02_00330383 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198129 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226990 predicted 7742
2 SASI_Hs02_00371671 predicted 7653
3 SASI_Hs01_00226991 predicted 7565
4 SASI_Hs01_00226993 predicted 8166
5 SASI_Hs01_00226994 predicted 8332
6 SASI_Hs02_00371672 predicted 5708
7 SASI_Hs01_00226995 predicted 7630
8 SASI_Hs01_00226996 predicted 7524
9 SASI_Hs02_00371673 predicted 7614
10 SASI_Hs01_00226997 predicted 6903
11 SASI_Hs01_00226989 predicted 9181
12 SASI_Hs01_00226992 predicted 8998
13 SASI_Hs01_00226998 predicted 7705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269388 predicted 3364
2 SASI_Rn02_00269389 predicted 2735
3 SASI_Rn02_00269390 predicted 2389
4 SASI_Rn02_00269391 predicted 2222
5 SASI_Rn02_00269392 predicted 3128
6 SASI_Rn02_00269393 predicted 3891
7 SASI_Rn02_00269394 predicted 4804
8 SASI_Rn02_00269395 predicted 3473
9 SASI_Rn02_00269396 predicted 2678
10 SASI_Rn02_00269397 predicted 3260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00257356 predicted 1559
2 SASI_Mm01_00257357 predicted 2383
3 SASI_Mm01_00257359 predicted 10043
4 SASI_Mm01_00257360 predicted 7438
5 SASI_Mm02_00424958 predicted 1403
6 SASI_Mm02_00424959 predicted 7080
7 SASI_Mm01_00257361 predicted 5985
8 SASI_Mm02_00424960 predicted 9565
9 SASI_Mm01_00257362 predicted 8716
10 SASI_Mm02_00424961 predicted 3907
11 SASI_Mm01_00257358 predicted 865
12 SASI_Mm01_00257363 predicted 8661
13 SASI_Mm01_00257364 predicted 600
14 SASI_Mm01_00257365 predicted 4392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00447661 predicted 1589
2 SASI_Mm02_00447662 predicted 2400
3 SASI_Mm02_00447663 predicted 10064
4 SASI_Mm02_00447664 predicted 7452
5 SASI_Mm02_00447665 predicted 1430
6 SASI_Mm02_00447666 predicted 6006
7 SASI_Mm02_00447667 predicted 9580
8 SASI_Mm02_00447668 predicted 8731
9 SASI_Mm02_00447669 predicted 3924
10 SASI_Mm02_00447670 predicted 7720
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000227
VALIDATED
LAMA3 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-218s21c1
Sequence:CCGGCGGGATCATAAAGGCTTGTATCTCGAGATACAAGCCTTTATGATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000227.3-5308s21c1
Sequence:CCGGAGGTTTAATAGCGAATCTAATCTCGAGATTAGATTCGCTATTAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-4281s21c1
Sequence:CCGGCGGGCACTAAGAACTCCTTTACTCGAGTAAAGGAGTTCTTAGTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-1270s21c1
Sequence:CCGGCCGGGATTCTTTAAATGAATACTCGAGTATTCATTTAAAGAATCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-196s1c1
Sequence:CCGGCGGGATCATAAAGGCTTGTATCTCGAGATACAAGCCTTTATGATCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-2841s1c1
Sequence:CCGGCCCTCCATACAAAGGTTGTATCTCGAGATACAACCTTTGTATGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-2863s21c1
Sequence:CCGGCCCTCCATACAAAGGTTGTATCTCGAGATACAACCTTTGTATGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-4259s1c1
Sequence:CCGGCGGGCACTAAGAACTCCTTTACTCGAGTAAAGGAGTTCTTAGTGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000227.2-1248s1c1
Sequence:CCGGCCGGGATTCTTTAAATGAATACTCGAGTATTCATTTAAAGAATCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000227.2-5285s1c1
Sequence:CCGGCAGGTTTAATAGCGAATCTAACTCGAGTTAGATTCGCTATTAAACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000227
VALIDATED
LAMA3 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-218s21c1
Sequence:CCGGCGGGATCATAAAGGCTTGTATCTCGAGATACAAGCCTTTATGATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000227.3-5308s21c1
Sequence:CCGGAGGTTTAATAGCGAATCTAATCTCGAGATTAGATTCGCTATTAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-4281s21c1
Sequence:CCGGCGGGCACTAAGAACTCCTTTACTCGAGTAAAGGAGTTCTTAGTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-1270s21c1
Sequence:CCGGCCGGGATTCTTTAAATGAATACTCGAGTATTCATTTAAAGAATCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-196s1c1
Sequence:CCGGCGGGATCATAAAGGCTTGTATCTCGAGATACAAGCCTTTATGATCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-2841s1c1
Sequence:CCGGCCCTCCATACAAAGGTTGTATCTCGAGATACAACCTTTGTATGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-2863s21c1
Sequence:CCGGCCCTCCATACAAAGGTTGTATCTCGAGATACAACCTTTGTATGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-4259s1c1
Sequence:CCGGCGGGCACTAAGAACTCCTTTACTCGAGTAAAGGAGTTCTTAGTGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000227.2-1248s1c1
Sequence:CCGGCCGGGATTCTTTAAATGAATACTCGAGTATTCATTTAAAGAATCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000227.2-5285s1c1
Sequence:CCGGCAGGTTTAATAGCGAATCTAACTCGAGTTAGATTCGCTATTAAACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000227
VALIDATED
LAMA3 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-218s21c1
Sequence:CCGGCGGGATCATAAAGGCTTGTATCTCGAGATACAAGCCTTTATGATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000227.3-5308s21c1
Sequence:CCGGAGGTTTAATAGCGAATCTAATCTCGAGATTAGATTCGCTATTAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-4281s21c1
Sequence:CCGGCGGGCACTAAGAACTCCTTTACTCGAGTAAAGGAGTTCTTAGTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335821    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-1270s21c1
Sequence:CCGGCCGGGATTCTTTAAATGAATACTCGAGTATTCATTTAAAGAATCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-196s1c1
Sequence:CCGGCGGGATCATAAAGGCTTGTATCTCGAGATACAAGCCTTTATGATCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-2841s1c1
Sequence:CCGGCCCTCCATACAAAGGTTGTATCTCGAGATACAACCTTTGTATGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000227.3-2863s21c1
Sequence:CCGGCCCTCCATACAAAGGTTGTATCTCGAGATACAACCTTTGTATGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000227.2-4259s1c1
Sequence:CCGGCGGGCACTAAGAACTCCTTTACTCGAGTAAAGGAGTTCTTAGTGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000227.2-1248s1c1
Sequence:CCGGCCGGGATTCTTTAAATGAATACTCGAGTATTCATTTAAAGAATCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005438    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000227.2-5285s1c1
Sequence:CCGGCAGGTTTAATAGCGAATCTAACTCGAGTTAGATTCGCTATTAAACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_140451
LAMA3 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_140451.7-10164s21c1
Sequence:CCGGCACACAACACTTTAGTTAATACTCGAGTATTAACTAAAGTGTTGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-8642s21c1
Sequence:CCGGTCAGCATGGGAGGCGGTTATTCTCGAGAATAACCGCCTCCCATGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-1436s21c1
Sequence:CCGGATCCAGTGGCTGGCAATATAACTCGAGTTATATTGCCAGCCACTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-4991s21c1
Sequence:CCGGGTTGTCGCCCTGGATACTATTCTCGAGAATAGTATCCAGGGCGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-1822s21c1
Sequence:CCGGAGTGTCTGCAAACCATTATATCTCGAGATATAATGGTTTGCAGACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_140451
LAMA3 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_140451.7-10164s21c1
Sequence:CCGGCACACAACACTTTAGTTAATACTCGAGTATTAACTAAAGTGTTGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-8642s21c1
Sequence:CCGGTCAGCATGGGAGGCGGTTATTCTCGAGAATAACCGCCTCCCATGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-1436s21c1
Sequence:CCGGATCCAGTGGCTGGCAATATAACTCGAGTTATATTGCCAGCCACTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-4991s21c1
Sequence:CCGGGTTGTCGCCCTGGATACTATTCTCGAGAATAGTATCCAGGGCGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000239269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-1822s21c1
Sequence:CCGGAGTGTCTGCAAACCATTATATCTCGAGATATAATGGTTTGCAGACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_140451
LAMA3 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_140451.7-10164s21c1
Sequence:CCGGCACACAACACTTTAGTTAATACTCGAGTATTAACTAAAGTGTTGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-8642s21c1
Sequence:CCGGTCAGCATGGGAGGCGGTTATTCTCGAGAATAACCGCCTCCCATGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-1436s21c1
Sequence:CCGGATCCAGTGGCTGGCAATATAACTCGAGTTATATTGCCAGCCACTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-4991s21c1
Sequence:CCGGGTTGTCGCCCTGGATACTATTCTCGAGAATAGTATCCAGGGCGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000239269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_140451.7-1822s21c1
Sequence:CCGGAGTGTCTGCAAACCATTATATCTCGAGATATAATGGTTTGCAGACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)