EMAIL THIS PAGE TO A FRIEND

LAMA4

laminin, alpha 4

135 Gene Product Result for
Synonyms: CMD1JJ LAMA3 LAMA4*-1
Gene ID:
Human(3910) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
Mouse(16775) laminin, alpha 4
Rat(309816) laminin, alpha 4
naked mole-rat(101716530) laminin, alpha 4
sheep(101107969) laminin, alpha 4
Domestic Rabbit(100352418) laminin, alpha 4
Zebrafish(566796) laminin, alpha 4
cow(529670) laminin, alpha 4
chicken(421749) laminin, alpha 4
Horse(100066875) laminin, alpha 4
domestic cat(101086907) laminin, alpha 4
dog(475034) laminin, alpha 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002290 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105206 Rosetta Predictions human pricing
NM_001105207 Rosetta Predictions human pricing
NM_001105208 Rosetta Predictions human pricing
NM_001105209 Rosetta Predictions human pricing
NM_002290 Rosetta Predictions human pricing
NM_001107635 Rosetta Predictions rat pricing
NM_010681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323984 predicted 729
2 SASI_Hs02_00323985 predicted 1447
3 SASI_Hs02_00323986 predicted 3345
4 SASI_Hs02_00323987 predicted 2910
5 SASI_Hs02_00323988 predicted 3010
6 SASI_Hs02_00323989 predicted 2859
7 SASI_Hs02_00323990 predicted 575
8 SASI_Hs02_00323991 predicted 1790
9 SASI_Hs02_00323992 predicted 1923
10 SASI_Hs02_00323993 predicted 3091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323994 predicted 752
2 SASI_Hs02_00323995 predicted 1437
3 SASI_Hs02_00323996 predicted 3342
4 SASI_Hs02_00323997 predicted 2899
5 SASI_Hs02_00323998 predicted 3008
6 SASI_Hs02_00323999 predicted 2860
7 SASI_Hs02_00324000 predicted 1790
8 SASI_Hs02_00324001 predicted 1924
9 SASI_Hs02_00324002 predicted 3079
10 SASI_Hs02_00324003 predicted 1582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105208 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324004 predicted 418
2 SASI_Hs02_00324005 predicted 418
3 SASI_Hs02_00324006 predicted 629
4 SASI_Hs02_00324007 predicted 488
5 SASI_Hs02_00324008 predicted 316
6 SASI_Hs02_00324009 predicted 556
7 SASI_Hs02_00324010 predicted 550
8 SASI_Hs02_00324011 predicted 547
9 SASI_Hs02_00324012 predicted 621
10 SASI_Hs02_00324013 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324014 predicted 438
2 SASI_Hs02_00324015 predicted 435
3 SASI_Hs02_00324016 predicted 640
4 SASI_Hs02_00324017 predicted 505
5 SASI_Hs02_00324018 predicted 330
6 SASI_Hs02_00324019 predicted 572
7 SASI_Hs02_00324020 predicted 572
8 SASI_Hs02_00324021 predicted 561
9 SASI_Hs02_00324022 predicted 640
10 SASI_Hs02_00324023 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158056 predicted 728
2 SASI_Hs01_00158058 predicted 1423
3 SASI_Hs01_00158059 predicted 3325
4 SASI_Hs02_00333583 predicted 2886
5 SASI_Hs01_00158060 predicted 2982
6 SASI_Hs01_00158061 predicted 2847
7 SASI_Hs02_00333584 predicted 1769
8 SASI_Hs01_00158063 predicted 1904
9 SASI_Hs01_00158065 predicted 3061
10 SASI_Hs02_00333585 predicted 1569
11 SASI_Hs01_00158057 predicted 1730
12 SASI_Hs01_00158062 predicted 4809
13 SASI_Hs01_00158064 predicted 1743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230775 predicted 1174
2 SASI_Rn02_00230776 predicted 997
3 SASI_Rn02_00230777 predicted 1503
4 SASI_Rn02_00230778 predicted 1645
5 SASI_Rn02_00230779 predicted 1055
6 SASI_Rn02_00230780 predicted 1161
7 SASI_Rn02_00230781 predicted 1125
8 SASI_Rn02_00230782 predicted 790
9 SASI_Rn02_00230783 predicted 1516
10 SASI_Rn02_00230784 predicted 789
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053183 predicted 756
2 SASI_Mm01_00053184 predicted 1478
3 SASI_Mm01_00053185 predicted 3261
4 SASI_Mm01_00053186 predicted 5066
5 SASI_Mm01_00053187 predicted 591
6 SASI_Mm01_00053188 predicted 2027
7 SASI_Mm01_00053189 predicted 3136
8 SASI_Mm02_00319118 predicted 1832
9 SASI_Mm01_00053190 predicted 4736
10 SASI_Mm01_00053191 predicted 2794
11 SASI_Mm01_00053182 predicted 3561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002290
LAMA4 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-4696s1c1
Sequence:CCGGCCGCCAAGAGTTTGAACACTTCTCGAGAAGTGTTCAAACTCTTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-4525s1c1
Sequence:CCGGGCCTAAAGCAAGTCAGAATAACTCGAGTTATTCTGACTTGCTTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-1258s1c1
Sequence:CCGGCGCCCTAAGAAAGATACAAATCTCGAGATTTGTATCTTTCTTAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002290.2-5752s1c1
Sequence:CCGGGCCCAAATACAAAGTTCTTTACTCGAGTAAAGAACTTTGTATTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-2980s1c1
Sequence:CCGGCGTCTATAATTTGGGAACTAACTCGAGTTAGTTCCCAAATTATAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002290.3-2223s21c1
Sequence:CCGGGAACACCACTGACCGAATTTACTCGAGTAAATTCGGTCAGTGGTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002290.3-5890s21c1
Sequence:CCGGATCATCAGGGACCGGATATTTCTCGAGAAATATCCGGTCCCTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002290
LAMA4 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-4696s1c1
Sequence:CCGGCCGCCAAGAGTTTGAACACTTCTCGAGAAGTGTTCAAACTCTTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-4525s1c1
Sequence:CCGGGCCTAAAGCAAGTCAGAATAACTCGAGTTATTCTGACTTGCTTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-1258s1c1
Sequence:CCGGCGCCCTAAGAAAGATACAAATCTCGAGATTTGTATCTTTCTTAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002290.2-5752s1c1
Sequence:CCGGGCCCAAATACAAAGTTCTTTACTCGAGTAAAGAACTTTGTATTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-2980s1c1
Sequence:CCGGCGTCTATAATTTGGGAACTAACTCGAGTTAGTTCCCAAATTATAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002290.3-2223s21c1
Sequence:CCGGGAACACCACTGACCGAATTTACTCGAGTAAATTCGGTCAGTGGTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002290.3-5890s21c1
Sequence:CCGGATCATCAGGGACCGGATATTTCTCGAGAAATATCCGGTCCCTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002290
LAMA4 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-4696s1c1
Sequence:CCGGCCGCCAAGAGTTTGAACACTTCTCGAGAAGTGTTCAAACTCTTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-4525s1c1
Sequence:CCGGGCCTAAAGCAAGTCAGAATAACTCGAGTTATTCTGACTTGCTTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-1258s1c1
Sequence:CCGGCGCCCTAAGAAAGATACAAATCTCGAGATTTGTATCTTTCTTAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119207    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002290.2-5752s1c1
Sequence:CCGGGCCCAAATACAAAGTTCTTTACTCGAGTAAAGAACTTTGTATTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002290.2-2980s1c1
Sequence:CCGGCGTCTATAATTTGGGAACTAACTCGAGTTAGTTCCCAAATTATAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002290.3-2223s21c1
Sequence:CCGGGAACACCACTGACCGAATTTACTCGAGTAAATTCGGTCAGTGGTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002290.3-5890s21c1
Sequence:CCGGATCATCAGGGACCGGATATTTCTCGAGAAATATCCGGTCCCTGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010681
VALIDATED
LAMA4 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-3695s1c1
Sequence:CCGGCCCAGATTAATGATGCGAAATCTCGAGATTTCGCATCATTAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010681.1-4341s1c1
Sequence:CCGGGCAGACTCAAACAACTGAGAACTCGAGTTCTCAGTTGTTTGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-1843s1c1
Sequence:CCGGCGGGACCATGAGAAACAACATCTCGAGATGTTGTTTCTCATGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-2883s21c1
Sequence:CCGGCGCTTACTTTAGTATTGTCAACTCGAGTTGACAATACTAAAGTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-3694s1c1
Sequence:CCGGGCCCAGATTAATGATGCGAAACTCGAGTTTCGCATCATTAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010681.1-3093s1c1
Sequence:CCGGCGCTTACTTTAGTATTGTCAACTCGAGTTGACAATACTAAAGTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-1633s21c1
Sequence:CCGGCGGGACCATGAGAAACAACATCTCGAGATGTTGTTTCTCATGGTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-3485s21c1
Sequence:CCGGCCCAGATTAATGATGCGAAATCTCGAGATTTCGCATCATTAATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-3795s21c1
Sequence:CCGGGATATCTCGCAGAGCATATTTCTCGAGAAATATGCTCTGCGAGATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010681
VALIDATED
LAMA4 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-3695s1c1
Sequence:CCGGCCCAGATTAATGATGCGAAATCTCGAGATTTCGCATCATTAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010681.1-4341s1c1
Sequence:CCGGGCAGACTCAAACAACTGAGAACTCGAGTTCTCAGTTGTTTGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-1843s1c1
Sequence:CCGGCGGGACCATGAGAAACAACATCTCGAGATGTTGTTTCTCATGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-2883s21c1
Sequence:CCGGCGCTTACTTTAGTATTGTCAACTCGAGTTGACAATACTAAAGTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-3694s1c1
Sequence:CCGGGCCCAGATTAATGATGCGAAACTCGAGTTTCGCATCATTAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010681.1-3093s1c1
Sequence:CCGGCGCTTACTTTAGTATTGTCAACTCGAGTTGACAATACTAAAGTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-1633s21c1
Sequence:CCGGCGGGACCATGAGAAACAACATCTCGAGATGTTGTTTCTCATGGTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-3485s21c1
Sequence:CCGGCCCAGATTAATGATGCGAAATCTCGAGATTTCGCATCATTAATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-3795s21c1
Sequence:CCGGGATATCTCGCAGAGCATATTTCTCGAGAAATATGCTCTGCGAGATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010681
VALIDATED
LAMA4 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-3695s1c1
Sequence:CCGGCCCAGATTAATGATGCGAAATCTCGAGATTTCGCATCATTAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010681.1-4341s1c1
Sequence:CCGGGCAGACTCAAACAACTGAGAACTCGAGTTCTCAGTTGTTTGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-1843s1c1
Sequence:CCGGCGGGACCATGAGAAACAACATCTCGAGATGTTGTTTCTCATGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-2883s21c1
Sequence:CCGGCGCTTACTTTAGTATTGTCAACTCGAGTTGACAATACTAAAGTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010681.1-3694s1c1
Sequence:CCGGGCCCAGATTAATGATGCGAAACTCGAGTTTCGCATCATTAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010681.1-3093s1c1
Sequence:CCGGCGCTTACTTTAGTATTGTCAACTCGAGTTGACAATACTAAAGTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-1633s21c1
Sequence:CCGGCGGGACCATGAGAAACAACATCTCGAGATGTTGTTTCTCATGGTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-3485s21c1
Sequence:CCGGCCCAGATTAATGATGCGAAATCTCGAGATTTCGCATCATTAATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010681.3-3795s21c1
Sequence:CCGGGATATCTCGCAGAGCATATTTCTCGAGAAATATGCTCTGCGAGATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)