EMAIL THIS PAGE TO A FRIEND

LAMA5

laminin, alpha 5

99 Gene Product Result for
UniProtKB ID: O15230, Q8TDF8, Q8WZA7, Q9H1P1
Gene ID:
Human(3911) Summary: This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
Mouse(16776) laminin, alpha 5
Rat(140433) laminin, alpha 5
Zebrafish(321243) laminin, alpha 5
cow(506751) laminin, alpha 5
Horse(100058057) laminin, alpha 5
domestic cat(101083923) laminin, alpha 5
dog(442954) laminin, alpha 5
chicken(428148) laminin, alpha 5
sheep(101121444) laminin, alpha 5
naked mole-rat(101708732) laminin, alpha 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005560 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005560 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005560 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005560 Rosetta Predictions human pricing
XM_001060527 Rosetta Predictions rat pricing
XM_215963 Rosetta Predictions rat pricing
NM_001081171 Rosetta Predictions mouse pricing
XM_203796 Rosetta Predictions mouse pricing
XM_902375 Rosetta Predictions mouse pricing
XM_902376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005560 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061491 predicted 3318
2 SASI_Hs01_00061492 predicted 5196
3 SASI_Hs01_00061493 predicted 9886
4 SASI_Hs01_00061494 predicted 5606
5 SASI_Hs01_00061496 predicted 5876
6 SASI_Hs01_00061497 predicted 5296
7 SASI_Hs01_00061498 predicted 7937
8 SASI_Hs02_00339818 predicted 5654
9 SASI_Hs01_00061499 predicted 1885
10 SASI_Hs01_00061500 predicted 5605
11 SASI_Hs01_00061495 predicted 7083
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296852 predicted 1396
2 SASI_Rn02_00296853 predicted 7546
3 SASI_Rn02_00296854 predicted 10068
4 SASI_Rn02_00296855 predicted 834
5 SASI_Rn02_00296856 predicted 525
6 SASI_Rn02_00296857 predicted 6537
7 SASI_Rn02_00296858 predicted 7568
8 SASI_Rn02_00296859 predicted 7323
9 SASI_Rn02_00296860 predicted 668
10 SASI_Rn02_00296861 predicted 7557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376326 predicted 1396
2 SASI_Rn02_00376327 predicted 7539
3 SASI_Rn02_00376328 predicted 10071
4 SASI_Rn02_00376329 predicted 838
5 SASI_Rn02_00376330 predicted 529
6 SASI_Rn02_00376331 predicted 6536
7 SASI_Rn02_00376332 predicted 7569
8 SASI_Rn02_00376333 predicted 7320
9 SASI_Rn02_00376334 predicted 673
10 SASI_Rn02_00376335 predicted 7552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295881 predicted 757
2 SASI_Mm02_00295882 predicted 7558
3 SASI_Mm02_00295883 predicted 1399
4 SASI_Mm02_00295884 predicted 10047
5 SASI_Mm02_00295885 predicted 527
6 SASI_Mm02_00295886 predicted 1933
7 SASI_Mm02_00295887 predicted 7582
8 SASI_Mm02_00295888 predicted 1390
9 SASI_Mm02_00295889 predicted 4449
10 SASI_Mm02_00295890 predicted 2195
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281858 predicted 763
2 SASI_Mm01_00281859 predicted 7555
3 SASI_Mm01_00281860 predicted 1405
4 SASI_Mm01_00281861 predicted 10055
5 SASI_Mm01_00281862 predicted 538
6 SASI_Mm01_00281863 predicted 1942
7 SASI_Mm01_00281864 predicted 7589
8 SASI_Mm01_00281865 predicted 1394
9 SASI_Mm01_00281866 predicted 4457
10 SASI_Mm01_00281867 predicted 2201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212509 predicted 610
2 SASI_Mm01_00212510 predicted 2136
3 SASI_Mm01_00212511 predicted 1321
4 SASI_Mm01_00212512 predicted 2262
5 SASI_Mm01_00212513 predicted 999
6 SASI_Mm01_00212514 predicted 1381
7 SASI_Mm01_00212515 predicted 643
8 SASI_Mm01_00212516 predicted 1487
9 SASI_Mm01_00212517 predicted 777
10 SASI_Mm01_00212518 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209907 predicted 344
2 SASI_Mm01_00209908 predicted 624
3 SASI_Mm01_00209909 predicted 369
4 SASI_Mm01_00209910 predicted 541
5 SASI_Mm01_00209911 predicted 374
6 SASI_Mm01_00209912 predicted 624
7 SASI_Mm01_00209913 predicted 662
8 SASI_Mm01_00209914 predicted 612
9 SASI_Mm01_00209915 predicted 239
10 SASI_Mm01_00209916 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005560
VALIDATED
LAMA5 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-2518s21c1
Sequence:CCGGACTGGATCAGGCTGACTATTTCTCGAGAAATAGTCAGCCTGATCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-530s21c1
Sequence:CCGGGCCTACGTCCTCATCAAGTTTCTCGAGAAACTTGATGAGGACGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-11216s21c1
Sequence:CCGGCTCGCCTCATAGGTGTCTATTCTCGAGAATAGACACCTATGAGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-8766s21c1
Sequence:CCGGTCGAGATGGACACGCTGAATGCTCGAGCATTCAGCGTGTCCATCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005560.3-4245s21c1
Sequence:CCGGCCCTGGATAAATCCTATGACTCTCGAGAGTCATAGGATTTATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4245s1c1
Sequence:CCGGCCCTGGATAAATCCTATGACTCTCGAGAGTCATAGGATTTATCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005560.3-11216s1c1
Sequence:CCGGCTCGCCTCATAGGTGTCTATTCTCGAGAATAGACACCTATGAGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4849s1c1
Sequence:CCGGGCAGTGCTACTGTAAGGAGAACTCGAGTTCTCCTTACAGTAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-530s1c1
Sequence:CCGGGCCTACGTCCTCATCAAGTTTCTCGAGAAACTTGATGAGGACGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4246s1c1
Sequence:CCGGCCTGGATAAATCCTATGACTTCTCGAGAAGTCATAGGATTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005560
VALIDATED
LAMA5 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-2518s21c1
Sequence:CCGGACTGGATCAGGCTGACTATTTCTCGAGAAATAGTCAGCCTGATCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-530s21c1
Sequence:CCGGGCCTACGTCCTCATCAAGTTTCTCGAGAAACTTGATGAGGACGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-11216s21c1
Sequence:CCGGCTCGCCTCATAGGTGTCTATTCTCGAGAATAGACACCTATGAGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-8766s21c1
Sequence:CCGGTCGAGATGGACACGCTGAATGCTCGAGCATTCAGCGTGTCCATCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005560.3-4245s21c1
Sequence:CCGGCCCTGGATAAATCCTATGACTCTCGAGAGTCATAGGATTTATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4245s1c1
Sequence:CCGGCCCTGGATAAATCCTATGACTCTCGAGAGTCATAGGATTTATCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005560.3-11216s1c1
Sequence:CCGGCTCGCCTCATAGGTGTCTATTCTCGAGAATAGACACCTATGAGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4849s1c1
Sequence:CCGGGCAGTGCTACTGTAAGGAGAACTCGAGTTCTCCTTACAGTAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-530s1c1
Sequence:CCGGGCCTACGTCCTCATCAAGTTTCTCGAGAAACTTGATGAGGACGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4246s1c1
Sequence:CCGGCCTGGATAAATCCTATGACTTCTCGAGAAGTCATAGGATTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005560
VALIDATED
LAMA5 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-2518s21c1
Sequence:CCGGACTGGATCAGGCTGACTATTTCTCGAGAAATAGTCAGCCTGATCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-530s21c1
Sequence:CCGGGCCTACGTCCTCATCAAGTTTCTCGAGAAACTTGATGAGGACGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289056    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-11216s21c1
Sequence:CCGGCTCGCCTCATAGGTGTCTATTCTCGAGAATAGACACCTATGAGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_005560.3-8766s21c1
Sequence:CCGGTCGAGATGGACACGCTGAATGCTCGAGCATTCAGCGTGTCCATCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005560.3-4245s21c1
Sequence:CCGGCCCTGGATAAATCCTATGACTCTCGAGAGTCATAGGATTTATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4245s1c1
Sequence:CCGGCCCTGGATAAATCCTATGACTCTCGAGAGTCATAGGATTTATCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005560.3-11216s1c1
Sequence:CCGGCTCGCCTCATAGGTGTCTATTCTCGAGAATAGACACCTATGAGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4849s1c1
Sequence:CCGGGCAGTGCTACTGTAAGGAGAACTCGAGTTCTCCTTACAGTAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-530s1c1
Sequence:CCGGGCCTACGTCCTCATCAAGTTTCTCGAGAAACTTGATGAGGACGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005560.3-4246s1c1
Sequence:CCGGCCTGGATAAATCCTATGACTTCTCGAGAAGTCATAGGATTTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081171
VALIDATED
LAMA5 MISSION shRNA Bacterial Glycerol Stock
laminin, alpha 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-11232s21c1
Sequence:CCGGGGTTTGCCTACACTTTCTATGCTCGAGCATAGAAAGTGTAGGCAAACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-9333s21c1
Sequence:CCGGTGGCTGCATCAAGGGTATTAACTCGAGTTAATACCCTTGATGCAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-2332s21c1
Sequence:CCGGCCAAGCTGTGATCGCTGTAAACTCGAGTTTACAGCGATCACAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-7223s21c1
Sequence:CCGGCCCTGAACCAGGCCGTTAATACTCGAGTATTAACGGCCTGGTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081171.2-916s21c1
Sequence:CCGGACAGTCACCCGCAGGTATTATCTCGAGATAATACCTGCGGGTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081171
VALIDATED
LAMA5 MISSION shRNA shRNA Plasmid DNA
laminin, alpha 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-11232s21c1
Sequence:CCGGGGTTTGCCTACACTTTCTATGCTCGAGCATAGAAAGTGTAGGCAAACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-9333s21c1
Sequence:CCGGTGGCTGCATCAAGGGTATTAACTCGAGTTAATACCCTTGATGCAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-2332s21c1
Sequence:CCGGCCAAGCTGTGATCGCTGTAAACTCGAGTTTACAGCGATCACAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-7223s21c1
Sequence:CCGGCCCTGAACCAGGCCGTTAATACTCGAGTATTAACGGCCTGGTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000252846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081171.2-916s21c1
Sequence:CCGGACAGTCACCCGCAGGTATTATCTCGAGATAATACCTGCGGGTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081171
VALIDATED
LAMA5 MISSION shRNA Lentiviral Transduction Particles
laminin, alpha 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-11232s21c1
Sequence:CCGGGGTTTGCCTACACTTTCTATGCTCGAGCATAGAAAGTGTAGGCAAACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-9333s21c1
Sequence:CCGGTGGCTGCATCAAGGGTATTAACTCGAGTTAATACCCTTGATGCAGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-2332s21c1
Sequence:CCGGCCAAGCTGTGATCGCTGTAAACTCGAGTTTACAGCGATCACAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081171.2-7223s21c1
Sequence:CCGGCCCTGAACCAGGCCGTTAATACTCGAGTATTAACGGCCTGGTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000252846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081171.2-916s21c1
Sequence:CCGGACAGTCACCCGCAGGTATTATCTCGAGATAATACCTGCGGGTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)