EMAIL THIS PAGE TO A FRIEND

LAMB1

laminin, beta 1

74 Gene Product Result for
Synonyms: CLM LIS5
UniProtKB ID: P07942, Q14D91
Gene ID:
Human(3912) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 1. The beta 1 chain has 7 structurally distinct domains which it shares with other beta chain isomers. The C-terminal helical region containing domains I and II are separated by domain alpha, domains III and V contain several EGF-like repeats, and domains IV and VI have a globular conformation. Laminin, beta 1 is expressed in most tissues that produce basement membranes, and is one of the 3 chains constituting laminin 1, the first laminin isolated from Engelbreth-Holm-Swarm (EHS) tumor. A sequence in the beta 1 chain that is involved in cell attachment, chemotaxis, and binding to the laminin receptor was identified and shown to have the capacity to inhibit metastasis. [provided by RefSeq, Aug 2011]
Mouse(16777) laminin B1
Rat(298941) laminin, beta 1
naked mole-rat(101700233) laminin, beta 1
sheep(101105743) laminin, beta 1
Domestic Rabbit(100358679) laminin, beta 1
chicken(396478) laminin, beta 1
domestic cat(101080367) laminin, beta 1
cow(520030) laminin, beta 1
Horse(100060360) laminin, beta 1
dog(475882) laminin, beta 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002291 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002291 Rosetta Predictions human pricing
NM_001106721 Rosetta Predictions rat pricing
NM_008482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024496 predicted 3132
2 SASI_Hs01_00024497 predicted 2035
3 SASI_Hs01_00024499 predicted 4549
4 SASI_Hs01_00024501 predicted 2357
5 SASI_Hs01_00024502 predicted 2991
6 SASI_Hs02_00333586 predicted 1229
7 SASI_Hs02_00333587 predicted 696
8 SASI_Hs01_00024503 predicted 1120
9 SASI_Hs01_00024504 predicted 4486
10 SASI_Hs01_00024505 predicted 1018
11 SASI_Hs01_00024498 predicted 2147
12 SASI_Hs01_00024500 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106721 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221738 predicted 1863
2 SASI_Rn02_00221739 predicted 495
3 SASI_Rn02_00221740 predicted 2660
4 SASI_Rn02_00221741 predicted 930
5 SASI_Rn02_00221742 predicted 1295
6 SASI_Rn02_00221743 predicted 1348
7 SASI_Rn02_00221744 predicted 2392
8 SASI_Rn02_00221745 predicted 3110
9 SASI_Rn02_00221746 predicted 2533
10 SASI_Rn02_00221747 predicted 3113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065261 predicted 5153
2 SASI_Mm02_00314001 predicted 4171
3 SASI_Mm01_00065262 predicted 872
4 SASI_Mm01_00065263 predicted 438
5 SASI_Mm01_00065264 predicted 4931
6 SASI_Mm01_00065265 predicted 2320
7 SASI_Mm02_00314002 predicted 2396
8 SASI_Mm02_00314003 predicted 2287
9 SASI_Mm01_00065268 predicted 4827
10 SASI_Mm01_00065270 predicted 5541
11 SASI_Mm01_00065266 predicted 3974
12 SASI_Mm01_00065267 predicted 1509
13 SASI_Mm01_00065269 predicted 5215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008482
VALIDATED
LAMB1 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-3971s1c1
Sequence:CCGGCGCAGGTAGAAGTGAAATTAACTCGAGTTAATTTCACTTCTACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-829s1c1
Sequence:CCGGGACCCTTATAGTCCAAGGATACTCGAGTATCCTTGGACTATAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-841s1c1
Sequence:CCGGCCAAGGATACAGAATCTATTACTCGAGTAATAGATTCTGTATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-5483s1c1
Sequence:CCGGGCTCCCTCCTTAAGGACATAACTCGAGTTATGTCCTTAAGGAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008482.1-958s1c1
Sequence:CCGGGCTGTTTATGATATGGTGGTTCTCGAGAACCACCATATCATAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-935s21c1
Sequence:CCGGCCAAGGATACAGAATCTATTACTCGAGTAATAGATTCTGTATCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008482.2-923s21c1
Sequence:CCGGGACCCTTATAGTCCAAGGATACTCGAGTATCCTTGGACTATAAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-834s21c1
Sequence:CCGGTCATCTGTGACTCTCGATATTCTCGAGAATATCGAGAGTCACAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-4065s21c1
Sequence:CCGGCGCAGGTAGAAGTGAAATTAACTCGAGTTAATTTCACTTCTACCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008482.2-869s21c1
Sequence:CCGGTCGACAGAAGGAGAGGTAATACTCGAGTATTACCTCTCCTTCTGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008482
VALIDATED
LAMB1 MISSION shRNA shRNA Plasmid DNA
laminin, beta 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-3971s1c1
Sequence:CCGGCGCAGGTAGAAGTGAAATTAACTCGAGTTAATTTCACTTCTACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-829s1c1
Sequence:CCGGGACCCTTATAGTCCAAGGATACTCGAGTATCCTTGGACTATAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-841s1c1
Sequence:CCGGCCAAGGATACAGAATCTATTACTCGAGTAATAGATTCTGTATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-5483s1c1
Sequence:CCGGGCTCCCTCCTTAAGGACATAACTCGAGTTATGTCCTTAAGGAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008482.1-958s1c1
Sequence:CCGGGCTGTTTATGATATGGTGGTTCTCGAGAACCACCATATCATAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-935s21c1
Sequence:CCGGCCAAGGATACAGAATCTATTACTCGAGTAATAGATTCTGTATCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008482.2-923s21c1
Sequence:CCGGGACCCTTATAGTCCAAGGATACTCGAGTATCCTTGGACTATAAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-834s21c1
Sequence:CCGGTCATCTGTGACTCTCGATATTCTCGAGAATATCGAGAGTCACAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-4065s21c1
Sequence:CCGGCGCAGGTAGAAGTGAAATTAACTCGAGTTAATTTCACTTCTACCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008482.2-869s21c1
Sequence:CCGGTCGACAGAAGGAGAGGTAATACTCGAGTATTACCTCTCCTTCTGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008482
VALIDATED
LAMB1 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-3971s1c1
Sequence:CCGGCGCAGGTAGAAGTGAAATTAACTCGAGTTAATTTCACTTCTACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-829s1c1
Sequence:CCGGGACCCTTATAGTCCAAGGATACTCGAGTATCCTTGGACTATAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-841s1c1
Sequence:CCGGCCAAGGATACAGAATCTATTACTCGAGTAATAGATTCTGTATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008482.1-5483s1c1
Sequence:CCGGGCTCCCTCCTTAAGGACATAACTCGAGTTATGTCCTTAAGGAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008482.1-958s1c1
Sequence:CCGGGCTGTTTATGATATGGTGGTTCTCGAGAACCACCATATCATAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-935s21c1
Sequence:CCGGCCAAGGATACAGAATCTATTACTCGAGTAATAGATTCTGTATCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008482.2-923s21c1
Sequence:CCGGGACCCTTATAGTCCAAGGATACTCGAGTATCCTTGGACTATAAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-834s21c1
Sequence:CCGGTCATCTGTGACTCTCGATATTCTCGAGAATATCGAGAGTCACAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008482.2-4065s21c1
Sequence:CCGGCGCAGGTAGAAGTGAAATTAACTCGAGTTAATTTCACTTCTACCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008482.2-869s21c1
Sequence:CCGGTCGACAGAAGGAGAGGTAATACTCGAGTATTACCTCTCCTTCTGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002291
LAMB1 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-1884s1c1
Sequence:CCGGGCCTTAAACAACAGTTGCTTTCTCGAGAAAGCAACTGTTGTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-3210s1c1
Sequence:CCGGGCCTCAGGATACTTTGGCAATCTCGAGATTGCCAAAGTATCCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-4993s1c1
Sequence:CCGGGCCTTTCTCAAGTAGAGGTTACTCGAGTAACCTCTACTTGAGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-997s1c1
Sequence:CCGGGCCCAAGGATACAGAATTTATCTCGAGATAAATTCTGTATCCTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-998s1c1
Sequence:CCGGCCCAAGGATACAGAATTTATTCTCGAGAATAAATTCTGTATCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-1884s21c1
Sequence:CCGGGCCTTAAACAACAGTTGCTTTCTCGAGAAAGCAACTGTTGTTTAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-4993s21c1
Sequence:CCGGGCCTTTCTCAAGTAGAGGTTACTCGAGTAACCTCTACTTGAGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-3210s21c1
Sequence:CCGGGCCTCAGGATACTTTGGCAATCTCGAGATTGCCAAAGTATCCTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-998s21c1
Sequence:CCGGCCCAAGGATACAGAATTTATTCTCGAGAATAAATTCTGTATCCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002291
LAMB1 MISSION shRNA shRNA Plasmid DNA
laminin, beta 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-1884s1c1
Sequence:CCGGGCCTTAAACAACAGTTGCTTTCTCGAGAAAGCAACTGTTGTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-3210s1c1
Sequence:CCGGGCCTCAGGATACTTTGGCAATCTCGAGATTGCCAAAGTATCCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-4993s1c1
Sequence:CCGGGCCTTTCTCAAGTAGAGGTTACTCGAGTAACCTCTACTTGAGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-997s1c1
Sequence:CCGGGCCCAAGGATACAGAATTTATCTCGAGATAAATTCTGTATCCTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-998s1c1
Sequence:CCGGCCCAAGGATACAGAATTTATTCTCGAGAATAAATTCTGTATCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-1884s21c1
Sequence:CCGGGCCTTAAACAACAGTTGCTTTCTCGAGAAAGCAACTGTTGTTTAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-4993s21c1
Sequence:CCGGGCCTTTCTCAAGTAGAGGTTACTCGAGTAACCTCTACTTGAGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-3210s21c1
Sequence:CCGGGCCTCAGGATACTTTGGCAATCTCGAGATTGCCAAAGTATCCTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-998s21c1
Sequence:CCGGCCCAAGGATACAGAATTTATTCTCGAGAATAAATTCTGTATCCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002291
LAMB1 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-1884s1c1
Sequence:CCGGGCCTTAAACAACAGTTGCTTTCTCGAGAAAGCAACTGTTGTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-3210s1c1
Sequence:CCGGGCCTCAGGATACTTTGGCAATCTCGAGATTGCCAAAGTATCCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-4993s1c1
Sequence:CCGGGCCTTTCTCAAGTAGAGGTTACTCGAGTAACCTCTACTTGAGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-997s1c1
Sequence:CCGGGCCCAAGGATACAGAATTTATCTCGAGATAAATTCTGTATCCTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002291.1-998s1c1
Sequence:CCGGCCCAAGGATACAGAATTTATTCTCGAGAATAAATTCTGTATCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-1884s21c1
Sequence:CCGGGCCTTAAACAACAGTTGCTTTCTCGAGAAAGCAACTGTTGTTTAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-4993s21c1
Sequence:CCGGGCCTTTCTCAAGTAGAGGTTACTCGAGTAACCTCTACTTGAGAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-3210s21c1
Sequence:CCGGGCCTCAGGATACTTTGGCAATCTCGAGATTGCCAAAGTATCCTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002291.2-998s21c1
Sequence:CCGGCCCAAGGATACAGAATTTATTCTCGAGAATAAATTCTGTATCCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)