EMAIL THIS PAGE TO A FRIEND

LAMB2

laminin, beta 2 (laminin S)

51 Gene Product Result for
Synonyms: LAMS NPHS5
UniProtKB ID: P55268, Q16321
Gene ID:
Human(3913) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the beta chain isoform laminin, beta 2. The beta 2 chain contains the 7 structural domains typical of beta chains of laminin, including the short alpha region. However, unlike beta 1 chain, beta 2 has a more restricted tissue distribution. It is enriched in the basement membrane of muscles at the neuromuscular junctions, kidney glomerulus and vascular smooth muscle. Transgenic mice in which the beta 2 chain gene was inactivated by homologous recombination, showed defects in the maturation of neuromuscular junctions and impairment of glomerular filtration. Alternative splicing involving a non consensus 5' splice site (gc) in the 5' UTR of this gene has been reported. It was suggested that inefficient splicing of this first intron, which does not change the protein sequence, results in a greater abundance of the unspliced form of the transcript than the spliced form. The full-length nature of the spliced transcript is not known. [provided by RefSeq, Aug 2011]
Mouse(16779) laminin, beta 2
Rat(25473) laminin, beta 2
Zebrafish(337767) laminin, beta 2 (laminin S)
chicken(373980) laminin, beta 2 (laminin S)
cow(520167) laminin, beta 2 (laminin S)
domestic cat(101082047) laminin, beta 2 (laminin S)
dog(476626) laminin, beta 2 (laminin S)
sheep(101106719) laminin, beta 2 (laminin S)
domestic guinea pig(100732418) laminin, beta 2 (laminin S)
naked mole-rat(101706277) laminin, beta 2 (laminin S)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002292 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002292 Rosetta Predictions human pricing
NM_012974 Rosetta Predictions rat pricing
NM_008483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206444 predicted 1763
2 SASI_Hs01_00206445 predicted 996
3 SASI_Hs01_00206446 predicted 4245
4 SASI_Hs01_00206447 predicted 2358
5 SASI_Hs01_00206448 predicted 1375
6 SASI_Hs01_00206449 predicted 816
7 SASI_Hs01_00206450 predicted 4845
8 SASI_Hs01_00206452 predicted 4411
9 SASI_Hs01_00206453 predicted 1221
10 SASI_Hs02_00333588 predicted 5551
11 SASI_Hs01_00206451 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012974 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121826 predicted 1091
2 SASI_Rn01_00121827 predicted 1654
3 SASI_Rn01_00121829 predicted 4591
4 SASI_Rn01_00121830 predicted 380
5 SASI_Rn01_00121831 predicted 3540
6 SASI_Rn01_00121832 predicted 4782
7 SASI_Rn02_00260579 predicted 741
8 SASI_Rn01_00121833 predicted 922
9 SASI_Rn01_00121834 predicted 4199
10 SASI_Rn01_00121835 predicted 4057
11 SASI_Rn01_00121828 predicted 784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104772 predicted 4566
2 SASI_Mm01_00104773 predicted 775
3 SASI_Mm01_00104774 predicted 1067
4 SASI_Mm01_00104775 predicted 2562
5 SASI_Mm01_00104776 predicted 4252
6 SASI_Mm01_00104777 predicted 3868
7 SASI_Mm02_00314004 predicted 2111
8 SASI_Mm01_00104778 predicted 352
9 SASI_Mm01_00104779 predicted 5056
10 SASI_Mm02_00314005 predicted 5144
11 SASI_Mm01_00104780 predicted 4747
12 SASI_Mm01_00104781 predicted 4031
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002292
VALIDATED
LAMB2 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 2 (laminin S)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-1096s21c1
Sequence:CCGGTCCGAGAGAAGTACTACTATGCTCGAGCATAGTAGTACTTCTCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-1368s21c1
Sequence:CCGGCACTTCGACATGGCCGTATACCTCGAGGTATACGGCCATGTCGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-811s21c1
Sequence:CCGGCCTGGCATGTGTACCGATATTCTCGAGAATATCGGTACACATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002292.3-5645s21c1
Sequence:CCGGCGTGCTTCAAGCCATCAACTTCTCGAGAAGTTGATGGCTTGAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002292.2-2314s1c1
Sequence:CCGGCAGGTACTTGATATTTCCTAACTCGAGTTAGGAAATATCAAGTACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002292.3-2524s21c1
Sequence:CCGGCCACCTTTGAACGCTACCAATCTCGAGATTGGTAGCGTTCAAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-2523s1c1
Sequence:CCGGCCACCTTTGAACGCTACCAATCTCGAGATTGGTAGCGTTCAAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-5644s1c1
Sequence:CCGGCGTGCTTCAAGCCATCAACTTCTCGAGAAGTTGATGGCTTGAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002292.2-810s1c1
Sequence:CCGGCCTGGCATGTGTACCGATATTCTCGAGAATATCGGTACACATGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-3830s1c1
Sequence:CCGGCGTGCGTTCTCAGGAATCTTTCTCGAGAAAGATTCCTGAGAACGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002292
VALIDATED
LAMB2 MISSION shRNA shRNA Plasmid DNA
laminin, beta 2 (laminin S)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-1096s21c1
Sequence:CCGGTCCGAGAGAAGTACTACTATGCTCGAGCATAGTAGTACTTCTCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-1368s21c1
Sequence:CCGGCACTTCGACATGGCCGTATACCTCGAGGTATACGGCCATGTCGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-811s21c1
Sequence:CCGGCCTGGCATGTGTACCGATATTCTCGAGAATATCGGTACACATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002292.3-5645s21c1
Sequence:CCGGCGTGCTTCAAGCCATCAACTTCTCGAGAAGTTGATGGCTTGAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002292.2-2314s1c1
Sequence:CCGGCAGGTACTTGATATTTCCTAACTCGAGTTAGGAAATATCAAGTACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002292.3-2524s21c1
Sequence:CCGGCCACCTTTGAACGCTACCAATCTCGAGATTGGTAGCGTTCAAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-2523s1c1
Sequence:CCGGCCACCTTTGAACGCTACCAATCTCGAGATTGGTAGCGTTCAAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-5644s1c1
Sequence:CCGGCGTGCTTCAAGCCATCAACTTCTCGAGAAGTTGATGGCTTGAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002292.2-810s1c1
Sequence:CCGGCCTGGCATGTGTACCGATATTCTCGAGAATATCGGTACACATGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-3830s1c1
Sequence:CCGGCGTGCGTTCTCAGGAATCTTTCTCGAGAAAGATTCCTGAGAACGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002292
VALIDATED
LAMB2 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 2 (laminin S)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-1096s21c1
Sequence:CCGGTCCGAGAGAAGTACTACTATGCTCGAGCATAGTAGTACTTCTCTCGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000304155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-1368s21c1
Sequence:CCGGCACTTCGACATGGCCGTATACCTCGAGGTATACGGCCATGTCGAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_002292.3-811s21c1
Sequence:CCGGCCTGGCATGTGTACCGATATTCTCGAGAATATCGGTACACATGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000331395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002292.3-5645s21c1
Sequence:CCGGCGTGCTTCAAGCCATCAACTTCTCGAGAAGTTGATGGCTTGAAGCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002292.2-2314s1c1
Sequence:CCGGCAGGTACTTGATATTTCCTAACTCGAGTTAGGAAATATCAAGTACCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000300862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002292.3-2524s21c1
Sequence:CCGGCCACCTTTGAACGCTACCAATCTCGAGATTGGTAGCGTTCAAAGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-2523s1c1
Sequence:CCGGCCACCTTTGAACGCTACCAATCTCGAGATTGGTAGCGTTCAAAGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-5644s1c1
Sequence:CCGGCGTGCTTCAAGCCATCAACTTCTCGAGAAGTTGATGGCTTGAAGCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002292.2-810s1c1
Sequence:CCGGCCTGGCATGTGTACCGATATTCTCGAGAATATCGGTACACATGCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_002292.2-3830s1c1
Sequence:CCGGCGTGCGTTCTCAGGAATCTTTCTCGAGAAAGATTCCTGAGAACGCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008483
LAMB2 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 2 (laminin S)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-488s1c1
Sequence:CCGGCCACCTCATTATGACGTTCAACTCGAGTTGAACGTCATAATGAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-5136s1c1
Sequence:CCGGGCTGAGAAACAACTACGGGAACTCGAGTTCCCGTAGTTGTTTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-4628s1c1
Sequence:CCGGCGATCCTGACAGTATTGAAATCTCGAGATTTCAATACTGTCAGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-4632s1c1
Sequence:CCGGCCTGACAGTATTGAAATGGTACTCGAGTACCATTTCAATACTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-1103s1c1
Sequence:CCGGGCATACTCATAGCTGCCACTTCTCGAGAAGTGGCAGCTATGAGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008483
LAMB2 MISSION shRNA shRNA Plasmid DNA
laminin, beta 2 (laminin S)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-488s1c1
Sequence:CCGGCCACCTCATTATGACGTTCAACTCGAGTTGAACGTCATAATGAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-5136s1c1
Sequence:CCGGGCTGAGAAACAACTACGGGAACTCGAGTTCCCGTAGTTGTTTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-4628s1c1
Sequence:CCGGCGATCCTGACAGTATTGAAATCTCGAGATTTCAATACTGTCAGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-4632s1c1
Sequence:CCGGCCTGACAGTATTGAAATGGTACTCGAGTACCATTTCAATACTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-1103s1c1
Sequence:CCGGGCATACTCATAGCTGCCACTTCTCGAGAAGTGGCAGCTATGAGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008483
LAMB2 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 2 (laminin S)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-488s1c1
Sequence:CCGGCCACCTCATTATGACGTTCAACTCGAGTTGAACGTCATAATGAGGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000094116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-5136s1c1
Sequence:CCGGGCTGAGAAACAACTACGGGAACTCGAGTTCCCGTAGTTGTTTCTCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000094117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-4628s1c1
Sequence:CCGGCGATCCTGACAGTATTGAAATCTCGAGATTTCAATACTGTCAGGATCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000094115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-4632s1c1
Sequence:CCGGCCTGACAGTATTGAAATGGTACTCGAGTACCATTTCAATACTGTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000094118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008483.2-1103s1c1
Sequence:CCGGGCATACTCATAGCTGCCACTTCTCGAGAAGTGGCAGCTATGAGTATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???