EMAIL THIS PAGE TO A FRIEND

LAMB4

laminin, beta 4

27 Gene Product Result for
Gene ID:
sheep(101106520) laminin, beta 4
naked mole-rat(101699161) laminin, beta 4
Zebrafish(286831) laminin, beta 4
Horse(100060434) laminin, beta 4
domestic cat(101101552) laminin, beta 4
dog(483260) laminin, beta 4
chicken(396076) laminin, beta 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007356 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061221 MISSION® esiRNA esiRNA human LAMB4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007356 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110819 predicted 4403
2 SASI_Hs02_00343454 predicted 3931
3 SASI_Hs02_00343455 predicted 2749
4 SASI_Hs01_00110820 predicted 2067
5 SASI_Hs01_00110821 predicted 2998
6 SASI_Hs01_00110822 predicted 753
7 SASI_Hs02_00343456 predicted 3808
8 SASI_Hs01_00110825 predicted 2888
9 SASI_Hs01_00110826 predicted 4099
10 SASI_Hs01_00110828 predicted 2930
11 SASI_Hs01_00110823 predicted 1606
12 SASI_Hs01_00110824 predicted 2754
13 SASI_Hs01_00110827 predicted 4594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007356
LAMB4 MISSION shRNA Bacterial Glycerol Stock
laminin, beta 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-1343s1c1
Sequence:CCGGCCAGTGCCTTTGTAAAGAGAACTCGAGTTCTCTTTACAAAGGCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007356.1-5393s1c1
Sequence:CCGGCCTTTGTTTCTGGTTTCTGATCTCGAGATCAGAAACCAGAAACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-628s1c1
Sequence:CCGGGTGACTCCAAATACTCGGATACTCGAGTATCCGAGTATTTGGAGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-1908s1c1
Sequence:CCGGGCTGTCAACAACATTCCCTTTCTCGAGAAAGGGAATGTTGTTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-843s1c1
Sequence:CCGGGCTCTGTACGAGATGATTGTTCTCGAGAACAATCATCTCGTACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-492s1c1
Sequence:CCGGCCTGCTGCAATGTTAGTTGAACTCGAGTTCAACTAACATTGCAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-2103s1c1
Sequence:CCGGCCCATCTGTTTAGAACCAGATCTCGAGATCTGGTTCTAAACAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007356.1-5600s1c1
Sequence:CCGGCCTCTTACCTTCCTTTCTCTTCTCGAGAAGAGAAAGGAAGGTAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-2663s1c1
Sequence:CCGGCCCTTGCCCTTGTAATAGGTTCTCGAGAACCTATTACAAGGGCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-4587s1c1
Sequence:CCGGGCGAATGGTGTGCTTGACATTCTCGAGAATGTCAAGCACACCATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007356
LAMB4 MISSION shRNA shRNA Plasmid DNA
laminin, beta 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-1343s1c1
Sequence:CCGGCCAGTGCCTTTGTAAAGAGAACTCGAGTTCTCTTTACAAAGGCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007356.1-5393s1c1
Sequence:CCGGCCTTTGTTTCTGGTTTCTGATCTCGAGATCAGAAACCAGAAACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-628s1c1
Sequence:CCGGGTGACTCCAAATACTCGGATACTCGAGTATCCGAGTATTTGGAGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-1908s1c1
Sequence:CCGGGCTGTCAACAACATTCCCTTTCTCGAGAAAGGGAATGTTGTTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-843s1c1
Sequence:CCGGGCTCTGTACGAGATGATTGTTCTCGAGAACAATCATCTCGTACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-492s1c1
Sequence:CCGGCCTGCTGCAATGTTAGTTGAACTCGAGTTCAACTAACATTGCAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-2103s1c1
Sequence:CCGGCCCATCTGTTTAGAACCAGATCTCGAGATCTGGTTCTAAACAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007356.1-5600s1c1
Sequence:CCGGCCTCTTACCTTCCTTTCTCTTCTCGAGAAGAGAAAGGAAGGTAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-2663s1c1
Sequence:CCGGCCCTTGCCCTTGTAATAGGTTCTCGAGAACCTATTACAAGGGCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-4587s1c1
Sequence:CCGGGCGAATGGTGTGCTTGACATTCTCGAGAATGTCAAGCACACCATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007356
LAMB4 MISSION shRNA Lentiviral Transduction Particles
laminin, beta 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154101    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-1343s1c1
Sequence:CCGGCCAGTGCCTTTGTAAAGAGAACTCGAGTTCTCTTTACAAAGGCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007356.1-5393s1c1
Sequence:CCGGCCTTTGTTTCTGGTTTCTGATCTCGAGATCAGAAACCAGAAACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-628s1c1
Sequence:CCGGGTGACTCCAAATACTCGGATACTCGAGTATCCGAGTATTTGGAGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-1908s1c1
Sequence:CCGGGCTGTCAACAACATTCCCTTTCTCGAGAAAGGGAATGTTGTTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153340    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-843s1c1
Sequence:CCGGGCTCTGTACGAGATGATTGTTCTCGAGAACAATCATCTCGTACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-492s1c1
Sequence:CCGGCCTGCTGCAATGTTAGTTGAACTCGAGTTCAACTAACATTGCAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-2103s1c1
Sequence:CCGGCCCATCTGTTTAGAACCAGATCTCGAGATCTGGTTCTAAACAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007356.1-5600s1c1
Sequence:CCGGCCTCTTACCTTCCTTTCTCTTCTCGAGAAGAGAAAGGAAGGTAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007356.1-2663s1c1
Sequence:CCGGCCCTTGCCCTTGTAATAGGTTCTCGAGAACCTATTACAAGGGCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007356.1-4587s1c1
Sequence:CCGGGCGAATGGTGTGCTTGACATTCTCGAGAATGTCAAGCACACCATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)