EMAIL THIS PAGE TO A FRIEND

LAMC1

laminin, gamma 1 (formerly LAMB2)

200 Gene Product Result for
Synonyms: LAMB2
UniProtKB ID: P11047, Q5VYE7
Gene ID:
Human(3915) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
Mouse(226519) laminin, gamma 1
Rat(117036) laminin, gamma 1
Zebrafish(286832) laminin, gamma 1
cow(532572) laminin, gamma 1 (formerly LAMB2)
Horse(100053539) laminin, gamma 1 (formerly LAMB2)
domestic cat(101090321) laminin, gamma 1 (formerly LAMB2)
dog(480034) laminin, gamma 1 (formerly LAMB2)
chicken(424442) laminin, gamma 1 (formerly LAMB2)
domestic guinea pig(100734278) laminin, gamma 1 (formerly LAMB2)
naked mole-rat(101720256) laminin, gamma 1 (formerly LAMB2)
sheep(101105588) laminin, gamma 1 (formerly LAMB2)
Domestic Rabbit(100009388) laminin, gamma 1 (formerly LAMB2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2101314 Anti-LAMC1 (ab1) antibody produced in rabbit affinity isolated antibody human, horse, rat, mouse, dog, pig
western blot pricing
SAB2101315 Anti-LAMC1 (ab2) antibody produced in rabbit affinity isolated antibody bovine, pig, rabbit, horse, human, dog
western blot pricing
HPA001908 Anti-LAMC1 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
HPA001909 Anti-LAMC1 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse
immunohistochemistry, western blot pricing
SAB4501729 Anti-LAMC1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
WH0003915M1 Monoclonal Anti-LAMC1 antibody produced in mouse clone 2E6-B4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404015 Monoclonal Anti-LAMC1 antibody produced in mouse clone M1, purified immunoglobulin, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
AMAB91136 Monoclonal Anti-LAMC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3195, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91137 Monoclonal Anti-LAMC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3196, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91138 Monoclonal Anti-LAMC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3199, purified immunoglobulin, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
AMAB91140 Monoclonal Anti-LAMC1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3201, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010683 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010683 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010683 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002293 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002293 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002293 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002293 Rosetta Predictions human pricing
XM_001071300 Rosetta Predictions rat pricing
XM_341133 Rosetta Predictions rat pricing
NM_010683 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333589 predicted 782
2 SASI_Hs01_00149761 predicted 1905
3 SASI_Hs01_00149762 predicted 3369
4 SASI_Hs01_00149763 predicted 3456
5 SASI_Hs01_00149764 predicted 3590
6 SASI_Hs01_00149765 predicted 2238
7 SASI_Hs01_00149766 predicted 4240
8 SASI_Hs01_00149768 predicted 3597
9 SASI_Hs02_00333590 predicted 3829
10 SASI_Hs01_00149769 predicted 1404
11 SASI_Hs01_00149760 predicted 4911
12 SASI_Hs01_00149767 predicted 2572
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334590 predicted 4358
2 SASI_Rn02_00334591 predicted 1868
3 SASI_Rn02_00334592 predicted 2638
4 SASI_Rn02_00334593 predicted 3592
5 SASI_Rn02_00334594 predicted 2888
6 SASI_Rn02_00334595 predicted 3431
7 SASI_Rn02_00334596 predicted 2780
8 SASI_Rn02_00334597 predicted 767
9 SASI_Rn02_00334598 predicted 3372
10 SASI_Rn02_00334599 predicted 4198
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341133 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392433 predicted 4359
2 SASI_Rn02_00392434 predicted 1869
3 SASI_Rn02_00392435 predicted 2635
4 SASI_Rn02_00392436 predicted 3586
5 SASI_Rn02_00392437 predicted 2887
6 SASI_Rn02_00392438 predicted 3440
7 SASI_Rn02_00392439 predicted 2776
8 SASI_Rn02_00392440 predicted 766
9 SASI_Rn02_00392441 predicted 3375
10 SASI_Rn02_00392442 predicted 4197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319119 predicted 4358
2 SASI_Mm01_00126473 predicted 1893
3 SASI_Mm02_00319120 predicted 4335
4 SASI_Mm02_00319121 predicted 2057
5 SASI_Mm01_00126474 predicted 1011
6 SASI_Mm01_00126475 predicted 1951
7 SASI_Mm01_00126478 predicted 4968
8 SASI_Mm01_00126479 predicted 962
9 SASI_Mm01_00126480 predicted 3513
10 SASI_Mm01_00126482 predicted 761
11 SASI_Mm01_00126476 predicted 4359
12 SASI_Mm01_00126477 predicted 4196
13 SASI_Mm01_00126481 predicted 2934
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010683
VALIDATED
LAMC1 MISSION shRNA Bacterial Glycerol Stock
laminin, gamma 1 (formerly LAMB2)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-4978s1c1
Sequence:CCGGGCAGAGATCATTAAGGATATTCTCGAGAATATCCTTAATGATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-4979s21c1
Sequence:CCGGGCAGAGATCATTAAGGATATTCTCGAGAATATCCTTAATGATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-4082s1c1
Sequence:CCGGCCCTGGAGAATGAAGCAAATACTCGAGTATTTGCTTCATTCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-4083s21c1
Sequence:CCGGCCCTGGAGAATGAAGCAAATACTCGAGTATTTGCTTCATTCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010683.1-6203s1c1
Sequence:CCGGCCCATCTAGTTCCTGCACTTTCTCGAGAAAGTGCAGGAACTAGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-3376s1c1
Sequence:CCGGCGAGTGAAACTCCAGGAGTTACTCGAGTAACTCCTGGAGTTTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010683.1-2181s1c1
Sequence:CCGGCCTGAACAACTTGACCTCTATCTCGAGATAGAGGTCAAGTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-3377s21c1
Sequence:CCGGCGAGTGAAACTCCAGGAGTTACTCGAGTAACTCCTGGAGTTTCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-2182s21c1
Sequence:CCGGCCTGAACAACTTGACCTCTATCTCGAGATAGAGGTCAAGTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010683
VALIDATED
LAMC1 MISSION shRNA shRNA Plasmid DNA
laminin, gamma 1 (formerly LAMB2)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-4978s1c1
Sequence:CCGGGCAGAGATCATTAAGGATATTCTCGAGAATATCCTTAATGATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-4979s21c1
Sequence:CCGGGCAGAGATCATTAAGGATATTCTCGAGAATATCCTTAATGATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-4082s1c1
Sequence:CCGGCCCTGGAGAATGAAGCAAATACTCGAGTATTTGCTTCATTCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-4083s21c1
Sequence:CCGGCCCTGGAGAATGAAGCAAATACTCGAGTATTTGCTTCATTCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010683.1-6203s1c1
Sequence:CCGGCCCATCTAGTTCCTGCACTTTCTCGAGAAAGTGCAGGAACTAGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-3376s1c1
Sequence:CCGGCGAGTGAAACTCCAGGAGTTACTCGAGTAACTCCTGGAGTTTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010683.1-2181s1c1
Sequence:CCGGCCTGAACAACTTGACCTCTATCTCGAGATAGAGGTCAAGTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-3377s21c1
Sequence:CCGGCGAGTGAAACTCCAGGAGTTACTCGAGTAACTCCTGGAGTTTCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-2182s21c1
Sequence:CCGGCCTGAACAACTTGACCTCTATCTCGAGATAGAGGTCAAGTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010683
VALIDATED
LAMC1 MISSION shRNA Lentiviral Transduction Particles
laminin, gamma 1 (formerly LAMB2)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-4978s1c1
Sequence:CCGGGCAGAGATCATTAAGGATATTCTCGAGAATATCCTTAATGATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-4979s21c1
Sequence:CCGGGCAGAGATCATTAAGGATATTCTCGAGAATATCCTTAATGATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-4082s1c1
Sequence:CCGGCCCTGGAGAATGAAGCAAATACTCGAGTATTTGCTTCATTCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-4083s21c1
Sequence:CCGGCCCTGGAGAATGAAGCAAATACTCGAGTATTTGCTTCATTCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010683.1-6203s1c1
Sequence:CCGGCCCATCTAGTTCCTGCACTTTCTCGAGAAAGTGCAGGAACTAGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010683.1-3376s1c1
Sequence:CCGGCGAGTGAAACTCCAGGAGTTACTCGAGTAACTCCTGGAGTTTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010683.1-2181s1c1
Sequence:CCGGCCTGAACAACTTGACCTCTATCTCGAGATAGAGGTCAAGTTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-3377s21c1
Sequence:CCGGCGAGTGAAACTCCAGGAGTTACTCGAGTAACTCCTGGAGTTTCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010683.2-2182s21c1
Sequence:CCGGCCTGAACAACTTGACCTCTATCTCGAGATAGAGGTCAAGTTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002293
VALIDATED
LAMC1 MISSION shRNA Bacterial Glycerol Stock
laminin, gamma 1 (formerly LAMB2)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-3822s21c1
Sequence:CCGGCGTCATAAACAGGAAGCTGATCTCGAGATCAGCTTCCTGTTTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002293.2-6484s1c1
Sequence:CCGGCCCACCTTTGAGATTCATATACTCGAGTATATGAATCTCAAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-3864s1c1
Sequence:CCGGCGTCATAAACAGGAAGCTGATCTCGAGATCAGCTTCCTGTTTATGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-1468s1c1
Sequence:CCGGGCAACAATGAAGCCTGCTCTTCTCGAGAAGAGCAGGCTTCATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-1098s1c1
Sequence:CCGGCCCAAAGTTCTCAAGTCCTATCTCGAGATAGGACTTGAGAACTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002293.2-988s1c1
Sequence:CCGGGCGCCTATAACTTTGACAATACTCGAGTATTGTCAAAGTTATAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-1056s21c1
Sequence:CCGGCCCAAAGTTCTCAAGTCCTATCTCGAGATAGGACTTGAGAACTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-2240s21c1
Sequence:CCGGTGAGAGAAGTGCTGGATATTTCTCGAGAAATATCCAGCACTTCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-5517s21c1
Sequence:CCGGCATTGTGATGGCCAGTATATCCTCGAGGATATACTGGCCATCACAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-2841s21c1
Sequence:CCGGGACCGGTGCAAAGACGGATTTCTCGAGAAATCCGTCTTTGCACCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002293
VALIDATED
LAMC1 MISSION shRNA shRNA Plasmid DNA
laminin, gamma 1 (formerly LAMB2)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-3822s21c1
Sequence:CCGGCGTCATAAACAGGAAGCTGATCTCGAGATCAGCTTCCTGTTTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002293.2-6484s1c1
Sequence:CCGGCCCACCTTTGAGATTCATATACTCGAGTATATGAATCTCAAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-3864s1c1
Sequence:CCGGCGTCATAAACAGGAAGCTGATCTCGAGATCAGCTTCCTGTTTATGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-1468s1c1
Sequence:CCGGGCAACAATGAAGCCTGCTCTTCTCGAGAAGAGCAGGCTTCATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-1098s1c1
Sequence:CCGGCCCAAAGTTCTCAAGTCCTATCTCGAGATAGGACTTGAGAACTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002293.2-988s1c1
Sequence:CCGGGCGCCTATAACTTTGACAATACTCGAGTATTGTCAAAGTTATAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-1056s21c1
Sequence:CCGGCCCAAAGTTCTCAAGTCCTATCTCGAGATAGGACTTGAGAACTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-2240s21c1
Sequence:CCGGTGAGAGAAGTGCTGGATATTTCTCGAGAAATATCCAGCACTTCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-5517s21c1
Sequence:CCGGCATTGTGATGGCCAGTATATCCTCGAGGATATACTGGCCATCACAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-2841s21c1
Sequence:CCGGGACCGGTGCAAAGACGGATTTCTCGAGAAATCCGTCTTTGCACCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002293
VALIDATED
LAMC1 MISSION shRNA Lentiviral Transduction Particles
laminin, gamma 1 (formerly LAMB2)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-3822s21c1
Sequence:CCGGCGTCATAAACAGGAAGCTGATCTCGAGATCAGCTTCCTGTTTATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002293.2-6484s1c1
Sequence:CCGGCCCACCTTTGAGATTCATATACTCGAGTATATGAATCTCAAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-3864s1c1
Sequence:CCGGCGTCATAAACAGGAAGCTGATCTCGAGATCAGCTTCCTGTTTATGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-1468s1c1
Sequence:CCGGGCAACAATGAAGCCTGCTCTTCTCGAGAAGAGCAGGCTTCATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002293.2-1098s1c1
Sequence:CCGGCCCAAAGTTCTCAAGTCCTATCTCGAGATAGGACTTGAGAACTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002293.2-988s1c1
Sequence:CCGGGCGCCTATAACTTTGACAATACTCGAGTATTGTCAAAGTTATAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-1056s21c1
Sequence:CCGGCCCAAAGTTCTCAAGTCCTATCTCGAGATAGGACTTGAGAACTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-2240s21c1
Sequence:CCGGTGAGAGAAGTGCTGGATATTTCTCGAGAAATATCCAGCACTTCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344772    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-5517s21c1
Sequence:CCGGCATTGTGATGGCCAGTATATCCTCGAGGATATACTGGCCATCACAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002293.3-2841s21c1
Sequence:CCGGGACCGGTGCAAAGACGGATTTCTCGAGAAATCCGTCTTTGCACCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)