EMAIL THIS PAGE TO A FRIEND

LAMC2

laminin, gamma 2

161 Gene Product Result for
Synonyms: B2T BM600 CSF EBR2 EBR2A LAMB2T LAMNB2
Gene ID:
Human(3918) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
Mouse(16782) laminin, gamma 2
Rat(192362) laminin, gamma 2
sheep(100216328) laminin, gamma 2
naked mole-rat(101719910) laminin, gamma 2
chicken(408043) laminin, gamma 2
dog(442939) laminin, gamma 2
Horse(791245) laminin, gamma 2
cow(511043) laminin, gamma 2
domestic cat(101089571) laminin, gamma 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005562 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023131 MISSION® esiRNA esiRNA human LAMC2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005562 Rosetta Predictions human pricing
NM_018891 Rosetta Predictions human pricing
XM_001071267 Rosetta Predictions rat pricing
XM_213902 Rosetta Predictions rat pricing
NM_008485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136952 predicted 1089
2 SASI_Hs01_00136953 predicted 2827
3 SASI_Hs01_00136954 predicted 906
4 SASI_Hs01_00136956 predicted 1299
5 SASI_Hs01_00136957 predicted 3143
6 SASI_Hs02_00339826 predicted 1109
7 SASI_Hs01_00136958 predicted 1481
8 SASI_Hs01_00136960 predicted 1623
9 SASI_Hs01_00136961 predicted 1368
10 SASI_Hs02_00339827 predicted 1262
11 SASI_Hs01_00136955 predicted 1033
12 SASI_Hs01_00136959 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061840 predicted 1082
2 SASI_Hs01_00061841 predicted 2827
3 SASI_Hs01_00061842 predicted 907
4 SASI_Hs01_00061844 predicted 1306
5 SASI_Hs02_00352317 predicted 3148
6 SASI_Hs02_00352318 predicted 1101
7 SASI_Hs01_00061845 predicted 1482
8 SASI_Hs02_00352319 predicted 441
9 SASI_Hs01_00061847 predicted 1623
10 SASI_Hs01_00061848 predicted 1367
11 SASI_Hs01_00061843 predicted 1032
12 SASI_Hs01_00061846 predicted 587
13 SASI_Hs01_00061849 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334426 predicted 742
2 SASI_Rn02_00334427 predicted 3955
3 SASI_Rn02_00334428 predicted 1236
4 SASI_Rn02_00334429 predicted 1353
5 SASI_Rn02_00334430 predicted 917
6 SASI_Rn02_00334431 predicted 3875
7 SASI_Rn02_00334432 predicted 2955
8 SASI_Rn02_00334433 predicted 1471
9 SASI_Rn02_00334434 predicted 3962
10 SASI_Rn02_00334435 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374986 predicted 738
2 SASI_Rn02_00374987 predicted 3954
3 SASI_Rn02_00374988 predicted 1229
4 SASI_Rn02_00374989 predicted 1345
5 SASI_Rn02_00374990 predicted 918
6 SASI_Rn02_00374991 predicted 3881
7 SASI_Rn02_00374992 predicted 2955
8 SASI_Rn02_00374993 predicted 1470
9 SASI_Rn02_00374994 predicted 3963
10 SASI_Rn02_00374995 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00184243 predicted 1364
2 SASI_Mm01_00184244 predicted 745
3 SASI_Mm02_00314009 predicted 2325
4 SASI_Mm01_00184245 predicted 1012
5 SASI_Mm01_00184247 predicted 1488
6 SASI_Mm01_00184248 predicted 1571
7 SASI_Mm01_00184251 predicted 3973
8 SASI_Mm01_00184249 predicted 705
9 SASI_Mm02_00314010 predicted 3596
10 SASI_Mm01_00184250 predicted 3161
11 SASI_Mm01_00184242 predicted 2707
12 SASI_Mm01_00184246 predicted 1356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008485
VALIDATED
LAMC2 MISSION shRNA Bacterial Glycerol Stock
laminin, gamma 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008485.3-3997s21c1
Sequence:CCGGGGGTTTGTTCAGGTCCAATTCCTCGAGGAATTGGACCTGAACAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008485.3-1297s21c1
Sequence:CCGGAGCTGAGTTATTTCGAATATCCTCGAGGATATTCGAAATAACTCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008485.2-4335s1c1
Sequence:CCGGGCGAACAACTTAGAGGCTGTACTCGAGTACAGCCTCTAAGTTGTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-2361s1c1
Sequence:CCGGGCTAACGCAATGAAGCAACTACTCGAGTAGTTGCTTCATTGCGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-1097s1c1
Sequence:CCGGCGGAGAATATAGTACAGGGTACTCGAGTACCCTGTACTATATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-3551s1c1
Sequence:CCGGCCTGGAGAACATTCGAGACAACTCGAGTTGTCTCGAATGTTCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008485.3-3108s21c1
Sequence:CCGGGCCCAAGAAGCGCTAAGTATGCTCGAGCATACTTAGCGCTTCTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008485.3-4116s21c1
Sequence:CCGGATTGATCAAGGACCAACAAATCTCGAGATTTGTTGGTCCTTGATCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-3227s1c1
Sequence:CCGGGCTGGAGTTTGACACGGATAACTCGAGTTATCCGTGTCAAACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008485
VALIDATED
LAMC2 MISSION shRNA shRNA Plasmid DNA
laminin, gamma 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008485.3-3997s21c1
Sequence:CCGGGGGTTTGTTCAGGTCCAATTCCTCGAGGAATTGGACCTGAACAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008485.3-1297s21c1
Sequence:CCGGAGCTGAGTTATTTCGAATATCCTCGAGGATATTCGAAATAACTCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008485.2-4335s1c1
Sequence:CCGGGCGAACAACTTAGAGGCTGTACTCGAGTACAGCCTCTAAGTTGTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-2361s1c1
Sequence:CCGGGCTAACGCAATGAAGCAACTACTCGAGTAGTTGCTTCATTGCGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-1097s1c1
Sequence:CCGGCGGAGAATATAGTACAGGGTACTCGAGTACCCTGTACTATATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-3551s1c1
Sequence:CCGGCCTGGAGAACATTCGAGACAACTCGAGTTGTCTCGAATGTTCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008485.3-3108s21c1
Sequence:CCGGGCCCAAGAAGCGCTAAGTATGCTCGAGCATACTTAGCGCTTCTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008485.3-4116s21c1
Sequence:CCGGATTGATCAAGGACCAACAAATCTCGAGATTTGTTGGTCCTTGATCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-3227s1c1
Sequence:CCGGGCTGGAGTTTGACACGGATAACTCGAGTTATCCGTGTCAAACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008485
VALIDATED
LAMC2 MISSION shRNA Lentiviral Transduction Particles
laminin, gamma 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439386    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008485.3-3997s21c1
Sequence:CCGGGGGTTTGTTCAGGTCCAATTCCTCGAGGAATTGGACCTGAACAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008485.3-1297s21c1
Sequence:CCGGAGCTGAGTTATTTCGAATATCCTCGAGGATATTCGAAATAACTCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008485.2-4335s1c1
Sequence:CCGGGCGAACAACTTAGAGGCTGTACTCGAGTACAGCCTCTAAGTTGTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-2361s1c1
Sequence:CCGGGCTAACGCAATGAAGCAACTACTCGAGTAGTTGCTTCATTGCGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-1097s1c1
Sequence:CCGGCGGAGAATATAGTACAGGGTACTCGAGTACCCTGTACTATATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-3551s1c1
Sequence:CCGGCCTGGAGAACATTCGAGACAACTCGAGTTGTCTCGAATGTTCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008485.3-3108s21c1
Sequence:CCGGGCCCAAGAAGCGCTAAGTATGCTCGAGCATACTTAGCGCTTCTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008485.3-4116s21c1
Sequence:CCGGATTGATCAAGGACCAACAAATCTCGAGATTTGTTGGTCCTTGATCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008485.2-3227s1c1
Sequence:CCGGGCTGGAGTTTGACACGGATAACTCGAGTTATCCGTGTCAAACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005562
VALIDATED
LAMC2 MISSION shRNA Bacterial Glycerol Stock
laminin, gamma 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-2829s21c1
Sequence:CCGGATTGAAGCAGATAGGTCTTATCTCGAGATAAGACCTATCTGCTTCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-817s21c1
Sequence:CCGGGGTGTCGATCAGGTTACTATACTCGAGTATAGTAACCTGATCGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-3505s21c1
Sequence:CCGGAGCTGGAGTTTGACACGAATACTCGAGTATTCGTGTCAAACTCCAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-2521s21c1
Sequence:CCGGCCTTGGGAAACACTAACATTCCTCGAGGAATGTTAGTGTTTCCCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-849s1c1
Sequence:CCGGCCTGCCAAATTTCTTGGGAATCTCGAGATTCCCAAGAAATTTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005562.1-4662s1c1
Sequence:CCGGCCATCCATCTTTCCATCCATTCTCGAGAATGGATGGAAAGATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-335s1c1
Sequence:CCGGGCCCTGCAATTGTAACTCCAACTCGAGTTGGAGTTACAATTGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-1019s1c1
Sequence:CCGGGCTCACCAAGACTTACACATTCTCGAGAATGTGTAAGTCTTGGTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-1634s1c1
Sequence:CCGGGCCCTGTCAATGCAACAACAACTCGAGTTGTTGTTGCATTGACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005562
VALIDATED
LAMC2 MISSION shRNA shRNA Plasmid DNA
laminin, gamma 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-2829s21c1
Sequence:CCGGATTGAAGCAGATAGGTCTTATCTCGAGATAAGACCTATCTGCTTCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-817s21c1
Sequence:CCGGGGTGTCGATCAGGTTACTATACTCGAGTATAGTAACCTGATCGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-3505s21c1
Sequence:CCGGAGCTGGAGTTTGACACGAATACTCGAGTATTCGTGTCAAACTCCAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-2521s21c1
Sequence:CCGGCCTTGGGAAACACTAACATTCCTCGAGGAATGTTAGTGTTTCCCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-849s1c1
Sequence:CCGGCCTGCCAAATTTCTTGGGAATCTCGAGATTCCCAAGAAATTTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005562.1-4662s1c1
Sequence:CCGGCCATCCATCTTTCCATCCATTCTCGAGAATGGATGGAAAGATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-335s1c1
Sequence:CCGGGCCCTGCAATTGTAACTCCAACTCGAGTTGGAGTTACAATTGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-1019s1c1
Sequence:CCGGGCTCACCAAGACTTACACATTCTCGAGAATGTGTAAGTCTTGGTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-1634s1c1
Sequence:CCGGGCCCTGTCAATGCAACAACAACTCGAGTTGTTGTTGCATTGACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005562
VALIDATED
LAMC2 MISSION shRNA Lentiviral Transduction Particles
laminin, gamma 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-2829s21c1
Sequence:CCGGATTGAAGCAGATAGGTCTTATCTCGAGATAAGACCTATCTGCTTCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-817s21c1
Sequence:CCGGGGTGTCGATCAGGTTACTATACTCGAGTATAGTAACCTGATCGACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-3505s21c1
Sequence:CCGGAGCTGGAGTTTGACACGAATACTCGAGTATTCGTGTCAAACTCCAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005562.2-2521s21c1
Sequence:CCGGCCTTGGGAAACACTAACATTCCTCGAGGAATGTTAGTGTTTCCCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-849s1c1
Sequence:CCGGCCTGCCAAATTTCTTGGGAATCTCGAGATTCCCAAGAAATTTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005562.1-4662s1c1
Sequence:CCGGCCATCCATCTTTCCATCCATTCTCGAGAATGGATGGAAAGATGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-335s1c1
Sequence:CCGGGCCCTGCAATTGTAACTCCAACTCGAGTTGGAGTTACAATTGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-1019s1c1
Sequence:CCGGGCTCACCAAGACTTACACATTCTCGAGAATGTGTAAGTCTTGGTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_005562.1-1634s1c1
Sequence:CCGGGCCCTGTCAATGCAACAACAACTCGAGTTGTTGTTGCATTGACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)