EMAIL THIS PAGE TO A FRIEND

LAMC3

laminin, gamma 3

68 Gene Product Result for
Synonyms: OCCM
UniProtKB ID: Q9Y6N6, B1APX9, B1APY0, Q59H72
Gene ID:
Human(10319) Summary: Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
Mouse(23928) laminin gamma 3
Rat(311862) laminin gamma 3
Zebrafish(558958) laminin, gamma 3
chicken(417180) laminin, gamma 3
cow(518914) laminin, gamma 3
Horse(100069663) laminin, gamma 3
domestic cat(101098499) laminin, gamma 3
dog(491290) laminin, gamma 3
naked mole-rat(101697108) laminin, gamma 3
sheep(101122429) laminin, gamma 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011836 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011836 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011836 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006059 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006059 Rosetta Predictions human pricing
NM_001107830 Rosetta Predictions rat pricing
NM_011836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230707 predicted 2104
2 SASI_Hs01_00230709 predicted 3811
3 SASI_Hs01_00230710 predicted 2947
4 SASI_Hs01_00230711 predicted 1102
5 SASI_Hs01_00230712 predicted 2952
6 SASI_Hs01_00230713 predicted 1453
7 SASI_Hs01_00230714 predicted 3924
8 SASI_Hs01_00230716 predicted 2288
9 SASI_Hs02_00340818 predicted 3885
10 SASI_Hs02_00340819 predicted 1464
11 SASI_Hs01_00230708 predicted 1731
12 SASI_Hs01_00230715 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107830 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232695 predicted 1090
2 SASI_Rn02_00232696 predicted 4050
3 SASI_Rn02_00232697 predicted 1828
4 SASI_Rn02_00232698 predicted 410
5 SASI_Rn02_00232699 predicted 2632
6 SASI_Rn02_00232700 predicted 3869
7 SASI_Rn02_00232701 predicted 4635
8 SASI_Rn02_00232702 predicted 463
9 SASI_Rn02_00232703 predicted 407
10 SASI_Rn02_00232704 predicted 4855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118482 predicted 1753
2 SASI_Mm01_00118484 predicted 1885
3 SASI_Mm02_00321562 predicted 2323
4 SASI_Mm01_00118485 predicted 3133
5 SASI_Mm01_00118486 predicted 2306
6 SASI_Mm01_00118488 predicted 913
7 SASI_Mm01_00118489 predicted 4003
8 SASI_Mm01_00118490 predicted 3502
9 SASI_Mm01_00118491 predicted 2837
10 SASI_Mm02_00321563 predicted 1096
11 SASI_Mm01_00118483 predicted 468
12 SASI_Mm01_00118487 predicted 3281
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011836
LAMC3 MISSION shRNA Bacterial Glycerol Stock
laminin, gamma 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-1759s1c1
Sequence:CCGGCCAGTCATACTGACCCTCCAACTCGAGTTGGAGGGTCAGTATGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-3055s1c1
Sequence:CCGGCCCGGCTTTGTGGGCTATAAACTCGAGTTTATAGCCCACAAAGCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-3859s1c1
Sequence:CCGGCCTGAAGCAATGAACTTCCAACTCGAGTTGGAAGTTCATTGCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011836.2-5767s1c1
Sequence:CCGGCCCTGGCATTTCTTCCTGATACTCGAGTATCAGGAAGAAATGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-4003s1c1
Sequence:CCGGCCCTTTATGCAGCTACGCAATCTCGAGATTGCGTAGCTGCATAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011836.3-1100s21c1
Sequence:CCGGCGTTTGACAGGGAGCTCTATCCTCGAGGATAGAGCTCCCTGTCAAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011836.3-3530s21c1
Sequence:CCGGGATCCAGCACACCCACCAATTCTCGAGAATTGGTGGGTGTGCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011836
LAMC3 MISSION shRNA shRNA Plasmid DNA
laminin, gamma 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-1759s1c1
Sequence:CCGGCCAGTCATACTGACCCTCCAACTCGAGTTGGAGGGTCAGTATGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-3055s1c1
Sequence:CCGGCCCGGCTTTGTGGGCTATAAACTCGAGTTTATAGCCCACAAAGCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-3859s1c1
Sequence:CCGGCCTGAAGCAATGAACTTCCAACTCGAGTTGGAAGTTCATTGCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011836.2-5767s1c1
Sequence:CCGGCCCTGGCATTTCTTCCTGATACTCGAGTATCAGGAAGAAATGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-4003s1c1
Sequence:CCGGCCCTTTATGCAGCTACGCAATCTCGAGATTGCGTAGCTGCATAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011836.3-1100s21c1
Sequence:CCGGCGTTTGACAGGGAGCTCTATCCTCGAGGATAGAGCTCCCTGTCAAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011836.3-3530s21c1
Sequence:CCGGGATCCAGCACACCCACCAATTCTCGAGAATTGGTGGGTGTGCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011836
LAMC3 MISSION shRNA Lentiviral Transduction Particles
laminin, gamma 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-1759s1c1
Sequence:CCGGCCAGTCATACTGACCCTCCAACTCGAGTTGGAGGGTCAGTATGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-3055s1c1
Sequence:CCGGCCCGGCTTTGTGGGCTATAAACTCGAGTTTATAGCCCACAAAGCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-3859s1c1
Sequence:CCGGCCTGAAGCAATGAACTTCCAACTCGAGTTGGAAGTTCATTGCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011836.2-5767s1c1
Sequence:CCGGCCCTGGCATTTCTTCCTGATACTCGAGTATCAGGAAGAAATGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011836.2-4003s1c1
Sequence:CCGGCCCTTTATGCAGCTACGCAATCTCGAGATTGCGTAGCTGCATAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011836.3-1100s21c1
Sequence:CCGGCGTTTGACAGGGAGCTCTATCCTCGAGGATAGAGCTCCCTGTCAAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011836.3-3530s21c1
Sequence:CCGGGATCCAGCACACCCACCAATTCTCGAGAATTGGTGGGTGTGCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006059
LAMC3 MISSION shRNA Bacterial Glycerol Stock
laminin, gamma 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006059.2-4900s1c1
Sequence:CCGGAGGTGTGCCCATACAGACATTCTCGAGAATGTCTGTATGGGCACACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-4205s1c1
Sequence:CCGGCCTTGCAGACACGAGAAAGAACTCGAGTTCTTTCTCGTGTCTGCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-1194s1c1
Sequence:CCGGCGCTGTCAGGAGAATTTCTATCTCGAGATAGAAATTCTCCTGACAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-473s1c1
Sequence:CCGGGAAGGCTTATGAGATCACGTACTCGAGTACGTGATCTCATAAGCCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-2311s1c1
Sequence:CCGGCAGGTTTCTATGGCAACCCTTCTCGAGAAGGGTTGCCATAGAAACCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-4205s21c1
Sequence:CCGGCCTTGCAGACACGAGAAAGAACTCGAGTTCTTTCTCGTGTCTGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-2311s21c1
Sequence:CCGGCAGGTTTCTATGGCAACCCTTCTCGAGAAGGGTTGCCATAGAAACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-473s21c1
Sequence:CCGGGAAGGCTTATGAGATCACGTACTCGAGTACGTGATCTCATAAGCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006059.3-4900s21c1
Sequence:CCGGAGGTGTGCCCATACAGACATTCTCGAGAATGTCTGTATGGGCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006059
LAMC3 MISSION shRNA shRNA Plasmid DNA
laminin, gamma 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006059.2-4900s1c1
Sequence:CCGGAGGTGTGCCCATACAGACATTCTCGAGAATGTCTGTATGGGCACACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-4205s1c1
Sequence:CCGGCCTTGCAGACACGAGAAAGAACTCGAGTTCTTTCTCGTGTCTGCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-1194s1c1
Sequence:CCGGCGCTGTCAGGAGAATTTCTATCTCGAGATAGAAATTCTCCTGACAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-473s1c1
Sequence:CCGGGAAGGCTTATGAGATCACGTACTCGAGTACGTGATCTCATAAGCCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-2311s1c1
Sequence:CCGGCAGGTTTCTATGGCAACCCTTCTCGAGAAGGGTTGCCATAGAAACCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-4205s21c1
Sequence:CCGGCCTTGCAGACACGAGAAAGAACTCGAGTTCTTTCTCGTGTCTGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-2311s21c1
Sequence:CCGGCAGGTTTCTATGGCAACCCTTCTCGAGAAGGGTTGCCATAGAAACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-473s21c1
Sequence:CCGGGAAGGCTTATGAGATCACGTACTCGAGTACGTGATCTCATAAGCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006059.3-4900s21c1
Sequence:CCGGAGGTGTGCCCATACAGACATTCTCGAGAATGTCTGTATGGGCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006059
LAMC3 MISSION shRNA Lentiviral Transduction Particles
laminin, gamma 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006059.2-4900s1c1
Sequence:CCGGAGGTGTGCCCATACAGACATTCTCGAGAATGTCTGTATGGGCACACCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-4205s1c1
Sequence:CCGGCCTTGCAGACACGAGAAAGAACTCGAGTTCTTTCTCGTGTCTGCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-1194s1c1
Sequence:CCGGCGCTGTCAGGAGAATTTCTATCTCGAGATAGAAATTCTCCTGACAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-473s1c1
Sequence:CCGGGAAGGCTTATGAGATCACGTACTCGAGTACGTGATCTCATAAGCCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006059.2-2311s1c1
Sequence:CCGGCAGGTTTCTATGGCAACCCTTCTCGAGAAGGGTTGCCATAGAAACCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-4205s21c1
Sequence:CCGGCCTTGCAGACACGAGAAAGAACTCGAGTTCTTTCTCGTGTCTGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-2311s21c1
Sequence:CCGGCAGGTTTCTATGGCAACCCTTCTCGAGAAGGGTTGCCATAGAAACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006059.3-473s21c1
Sequence:CCGGGAAGGCTTATGAGATCACGTACTCGAGTACGTGATCTCATAAGCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006059.3-4900s21c1
Sequence:CCGGAGGTGTGCCCATACAGACATTCTCGAGAATGTCTGTATGGGCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)