EMAIL THIS PAGE TO A FRIEND

LAMP1

lysosomal-associated membrane protein 1

96 Gene Product Result for
Synonyms: CD107a LAMPA LGP120
UniProtKB ID: P11279, Q8WU33, Q96I40, Q9BRD2, Q9NP13
Gene ID:
Human(3916) Summary: The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may also play a role in tumor cell metastasis. [provided by RefSeq, Jul 2008]
Mouse(16783) lysosomal-associated membrane protein 1
Rat(25328) lysosomal-associated membrane protein 1
sheep(101119403) lysosomal-associated membrane protein 1
domestic guinea pig(100726596) lysosomal-associated membrane protein 1
naked mole-rat(101702697) lysosomal-associated membrane protein 1
Zebrafish(337357) lysosomal-associated membrane protein 1
cow(281897) lysosomal-associated membrane protein 1
domestic cat(100125859) lysosomal-associated membrane protein 1
dog(476995) lysosomal-associated membrane protein 1
chicken(396220) lysosomal-associated membrane protein 1
fruit fly(35411) CG3305 gene product from transcript CG3305-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB3500285 Anti-LAMP-1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
L1418 Anti-LAMP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence pricing
HPA014750 Anti-LAMP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
L0419 Anti-LAMP1−Cy3 antibody produced in rabbit 1-2 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat, mouse
immunofluorescence pricing
SAB4700416 Monoclonal Anti-CD107A azide free antibody produced in mouse clone H4A3, purified immunoglobulin, buffered aqueous solution human, nonhuman primates, mouse
flow cytometry pricing
SAB4700417 Monoclonal Anti-CD107a-APC antibody produced in mouse clone H4A3, purified immunoglobulin, buffered aqueous solution nonhuman primates, mouse, human
flow cytometry pricing
SAB4700418 Monoclonal Anti-CD107a-PE antibody produced in mouse clone H4A3, purified immunoglobulin, buffered aqueous solution mouse, nonhuman primates, human
flow cytometry pricing
AMAB91168 Monoclonal Anti-LAMP1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3482, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB91170 Monoclonal Anti-LAMP1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL3484, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AMAB91298 Monoclonal Anti-LAMP1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4463, purified immunoglobulin human
immunohistochemistry, western blot pricing
AMAB91299 Monoclonal Anti-LAMP1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4472, purified immunoglobulin human
immunohistochemistry, western blot pricing
AMAB91300 Monoclonal Anti-LAMP1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4489, purified immunoglobulin human
immunohistochemistry, western blot pricing
AMAB91301 Monoclonal Anti-LAMP1 antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL4490, purified immunoglobulin human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1557 Human LAMP1 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0419 AQUA Peptide GYLLTLDFT[K] mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010684 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010684 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010684 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005561 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005561 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005561 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005561 Rosetta Predictions human pricing
NM_012857 Rosetta Predictions rat pricing
NM_010684 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339819 predicted 1396
2 SASI_Hs02_00339820 predicted 1580
3 SASI_Hs02_00339821 predicted 690
4 SASI_Hs02_00339822 predicted 607
5 SASI_Hs02_00339823 predicted 707
6 SASI_Hs01_00101068 predicted 1000
7 SASI_Hs02_00339824 predicted 572
8 SASI_Hs01_00101070 predicted 586
9 SASI_Hs01_00101073 predicted 1028
10 SASI_Hs02_00339825 predicted 661
11 SASI_Hs01_00101066 predicted 518
12 SASI_Hs01_00101067 predicted 1095
13 SASI_Hs01_00101069 predicted 374
14 SASI_Hs01_00101071 predicted 375
15 SASI_Hs01_00101072 predicted 518
16 SASI_Hs01_00101074 predicted 475
17 SASI_Hs01_00101075 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012857 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260341 predicted 555
2 SASI_Rn01_00034921 predicted 360
3 SASI_Rn01_00034922 predicted 429
4 SASI_Rn02_00260342 predicted 571
5 SASI_Rn01_00034923 predicted 244
6 SASI_Rn01_00034924 predicted 363
7 SASI_Rn01_00034925 predicted 262
8 SASI_Rn01_00034927 predicted 736
9 SASI_Rn01_00034928 predicted 935
10 SASI_Rn01_00034929 predicted 408
11 SASI_Rn01_00034926 predicted 635
12 SASI_Rn01_00034930 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131889 predicted 873
2 SASI_Mm01_00131890 predicted 1252
3 SASI_Mm01_00131891 predicted 696
4 SASI_Mm01_00131892 predicted 1342
5 SASI_Mm01_00131893 predicted 886
6 SASI_Mm01_00131895 predicted 1321
7 SASI_Mm01_00131896 predicted 1237
8 SASI_Mm01_00131897 predicted 1162
9 SASI_Mm02_00319122 predicted 1177
10 SASI_Mm02_00319123 predicted 1240
11 SASI_Mm01_00131894 predicted 907
12 SASI_Mm01_00131898 predicted 1287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010684
VALIDATED
LAMP1 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-990s21c1
Sequence:CCGGGCGTTCAACATCAGCCCAAATCTCGAGATTTGGGCTGATGTTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010684.2-1609s21c1
Sequence:CCGGGCAACATTTACTATGCACAAACTCGAGTTTGTGCATAGTAAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-466s21c1
Sequence:CCGGGCAGTTCTTGTGGTAAAGAAACTCGAGTTTCTTTACCACAAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-876s21c1
Sequence:CCGGCCCACTGTATCCAAGTACAATCTCGAGATTGTACTTGGATACAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-742s1c1
Sequence:CCGGCAAGTACAATGTTACTGGTAACTCGAGTTACCAGTAACATTGTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-731s1c1
Sequence:CCGGCCCACTGTATCCAAGTACAATCTCGAGATTGTACTTGGATACAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-845s1c1
Sequence:CCGGGCGTTCAACATCAGCCCAAATCTCGAGATTTGGGCTGATGTTGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010684.1-321s1c1
Sequence:CCGGGCAGTTCTTGTGGTAAAGAAACTCGAGTTTCTTTACCACAAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-1464s1c1
Sequence:CCGGGCAACATTTACTATGCACAAACTCGAGTTTGTGCATAGTAAATGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010684
VALIDATED
LAMP1 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-990s21c1
Sequence:CCGGGCGTTCAACATCAGCCCAAATCTCGAGATTTGGGCTGATGTTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010684.2-1609s21c1
Sequence:CCGGGCAACATTTACTATGCACAAACTCGAGTTTGTGCATAGTAAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-466s21c1
Sequence:CCGGGCAGTTCTTGTGGTAAAGAAACTCGAGTTTCTTTACCACAAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-876s21c1
Sequence:CCGGCCCACTGTATCCAAGTACAATCTCGAGATTGTACTTGGATACAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-742s1c1
Sequence:CCGGCAAGTACAATGTTACTGGTAACTCGAGTTACCAGTAACATTGTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-731s1c1
Sequence:CCGGCCCACTGTATCCAAGTACAATCTCGAGATTGTACTTGGATACAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-845s1c1
Sequence:CCGGGCGTTCAACATCAGCCCAAATCTCGAGATTTGGGCTGATGTTGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010684.1-321s1c1
Sequence:CCGGGCAGTTCTTGTGGTAAAGAAACTCGAGTTTCTTTACCACAAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-1464s1c1
Sequence:CCGGGCAACATTTACTATGCACAAACTCGAGTTTGTGCATAGTAAATGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010684
VALIDATED
LAMP1 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-990s21c1
Sequence:CCGGGCGTTCAACATCAGCCCAAATCTCGAGATTTGGGCTGATGTTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332543    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010684.2-1609s21c1
Sequence:CCGGGCAACATTTACTATGCACAAACTCGAGTTTGTGCATAGTAAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-466s21c1
Sequence:CCGGGCAGTTCTTGTGGTAAAGAAACTCGAGTTTCTTTACCACAAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010684.2-876s21c1
Sequence:CCGGCCCACTGTATCCAAGTACAATCTCGAGATTGTACTTGGATACAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-742s1c1
Sequence:CCGGCAAGTACAATGTTACTGGTAACTCGAGTTACCAGTAACATTGTACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-731s1c1
Sequence:CCGGCCCACTGTATCCAAGTACAATCTCGAGATTGTACTTGGATACAGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-845s1c1
Sequence:CCGGGCGTTCAACATCAGCCCAAATCTCGAGATTTGGGCTGATGTTGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010684.1-321s1c1
Sequence:CCGGGCAGTTCTTGTGGTAAAGAAACTCGAGTTTCTTTACCACAAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010684.1-1464s1c1
Sequence:CCGGGCAACATTTACTATGCACAAACTCGAGTTTGTGCATAGTAAATGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005561
VALIDATED
LAMP1 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005561.3-709s21c1
Sequence:CCGGCTGACATCAGGGCAGATATAGCTCGAGCTATATCTGCCCTGATGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-422s21c1
Sequence:CCGGTGCTGCCTTCTCAGTGAACTACTCGAGTAGTTCACTGAGAAGGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005561.3-355s21c1
Sequence:CCGGGTGCGTCAGCAGCAATGTTTACTCGAGTAAACATTGCTGCTGACGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-1696s21c1
Sequence:CCGGCTATCGAAATGACGGTGTTAACTCGAGTTAACACCGTCATTTCGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-1277s21c1
Sequence:CCGGCGGCAATTCCTACAAGTGCAACTCGAGTTGCACTTGTAGGAATTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-1183s1c1
Sequence:CCGGCGGCAATTCCTACAAGTGCAACTCGAGTTGCACTTGTAGGAATTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-1063s1c1
Sequence:CCGGGAATGCAAGTTCTAGCCGGTTCTCGAGAACCGGCTAGAACTTGCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-328s1c1
Sequence:CCGGTGCTGCCTTCTCAGTGAACTACTCGAGTAGTTCACTGAGAAGGCAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005561.2-487s1c1
Sequence:CCGGCACTCTCAATTTCACGAGAAACTCGAGTTTCTCGTGAAATTGAGAGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005561.2-1087s1c1
Sequence:CCGGCCTACAAGGAATCCAGTTGAACTCGAGTTCAACTGGATTCCTTGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005561
VALIDATED
LAMP1 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005561.3-709s21c1
Sequence:CCGGCTGACATCAGGGCAGATATAGCTCGAGCTATATCTGCCCTGATGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-422s21c1
Sequence:CCGGTGCTGCCTTCTCAGTGAACTACTCGAGTAGTTCACTGAGAAGGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005561.3-355s21c1
Sequence:CCGGGTGCGTCAGCAGCAATGTTTACTCGAGTAAACATTGCTGCTGACGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-1696s21c1
Sequence:CCGGCTATCGAAATGACGGTGTTAACTCGAGTTAACACCGTCATTTCGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-1277s21c1
Sequence:CCGGCGGCAATTCCTACAAGTGCAACTCGAGTTGCACTTGTAGGAATTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-1183s1c1
Sequence:CCGGCGGCAATTCCTACAAGTGCAACTCGAGTTGCACTTGTAGGAATTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-1063s1c1
Sequence:CCGGGAATGCAAGTTCTAGCCGGTTCTCGAGAACCGGCTAGAACTTGCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-328s1c1
Sequence:CCGGTGCTGCCTTCTCAGTGAACTACTCGAGTAGTTCACTGAGAAGGCAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005561.2-487s1c1
Sequence:CCGGCACTCTCAATTTCACGAGAAACTCGAGTTTCTCGTGAAATTGAGAGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005561.2-1087s1c1
Sequence:CCGGCCTACAAGGAATCCAGTTGAACTCGAGTTCAACTGGATTCCTTGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005561
VALIDATED
LAMP1 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005561.3-709s21c1
Sequence:CCGGCTGACATCAGGGCAGATATAGCTCGAGCTATATCTGCCCTGATGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-422s21c1
Sequence:CCGGTGCTGCCTTCTCAGTGAACTACTCGAGTAGTTCACTGAGAAGGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005561.3-355s21c1
Sequence:CCGGGTGCGTCAGCAGCAATGTTTACTCGAGTAAACATTGCTGCTGACGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-1696s21c1
Sequence:CCGGCTATCGAAATGACGGTGTTAACTCGAGTTAACACCGTCATTTCGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_005561.3-1277s21c1
Sequence:CCGGCGGCAATTCCTACAAGTGCAACTCGAGTTGCACTTGTAGGAATTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-1183s1c1
Sequence:CCGGCGGCAATTCCTACAAGTGCAACTCGAGTTGCACTTGTAGGAATTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-1063s1c1
Sequence:CCGGGAATGCAAGTTCTAGCCGGTTCTCGAGAACCGGCTAGAACTTGCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005561.2-328s1c1
Sequence:CCGGTGCTGCCTTCTCAGTGAACTACTCGAGTAGTTCACTGAGAAGGCAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005561.2-487s1c1
Sequence:CCGGCACTCTCAATTTCACGAGAAACTCGAGTTTCTCGTGAAATTGAGAGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005561.2-1087s1c1
Sequence:CCGGCCTACAAGGAATCCAGTTGAACTCGAGTTCAACTGGATTCCTTGTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)