EMAIL THIS PAGE TO A FRIEND

LAMP2

lysosomal-associated membrane protein 2

235 Gene Product Result for
Synonyms: CD107b LAMP-2 LAMPB LGP110
Gene ID:
Human(3920) Summary: The protein encoded by this gene is a member of a family of membrane glycoproteins. This glycoprotein provides selectins with carbohydrate ligands. It may play a role in tumor cell metastasis. It may also function in the protection, maintenance, and adhesion of the lysosome. Alternative splicing of this gene results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Mouse(16784) lysosomal-associated membrane protein 2
Rat(24944) lysosomal-associated membrane protein 2
Zebrafish(541406) lysosomal membrane glycoprotein 2
domestic cat(100169945) lysosomal-associated membrane protein 2
Horse(100061837) lysosomal-associated membrane protein 2
cow(529148) lysosomal-associated membrane protein 2
dog(481037) lysosomal-associated membrane protein 2
chicken(414800) lysosomal-associated membrane protein 2
domestic guinea pig(100717075) lysosomal-associated membrane protein 2
naked mole-rat(101710608) lysosomal-associated membrane protein 2
sheep(101113307) lysosomal-associated membrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1558 Human LAMP2 ELISA for serum, plasma and cell culture supernatants human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0264 AQUA Peptide EQVVSVS[R] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010685 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010685 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010685 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002294 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122606 Rosetta Predictions human pricing
NM_002294 Rosetta Predictions human pricing
NM_013995 Rosetta Predictions human pricing
NM_017068 Rosetta Predictions rat pricing
NM_001017959 Rosetta Predictions mouse pricing
NM_010685 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327056 predicted 569
2 SASI_Hs02_00327057 predicted 836
3 SASI_Hs02_00327058 predicted 393
4 SASI_Hs02_00327059 predicted 913
5 SASI_Hs02_00327060 predicted 912
6 SASI_Hs02_00327061 predicted 1017
7 SASI_Hs02_00327062 predicted 548
8 SASI_Hs02_00327063 predicted 1010
9 SASI_Hs02_00327064 predicted 499
10 SASI_Hs02_00327065 predicted 894
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176260 predicted 570
2 SASI_Hs01_00176261 predicted 841
3 SASI_Hs01_00176262 predicted 393
4 SASI_Hs01_00176263 predicted 910
5 SASI_Hs02_00333591 predicted 911
6 SASI_Hs01_00176264 predicted 1017
7 SASI_Hs01_00176265 predicted 539
8 SASI_Hs01_00176266 predicted 1008
9 SASI_Hs01_00176268 predicted 499
10 SASI_Hs02_00333592 predicted 894
11 SASI_Hs01_00176267 predicted 803
12 SASI_Hs01_00176269 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013995 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113167 predicted 568
2 SASI_Hs01_00113168 predicted 834
3 SASI_Hs01_00113169 predicted 395
4 SASI_Hs01_00113170 predicted 915
5 SASI_Hs02_00344957 predicted 910
6 SASI_Hs01_00113171 predicted 1013
7 SASI_Hs01_00113172 predicted 543
8 SASI_Hs01_00113173 predicted 1004
9 SASI_Hs01_00113175 predicted 506
10 SASI_Hs02_00344958 predicted 894
11 SASI_Hs01_00113174 predicted 809
12 SASI_Hs01_00113176 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017068 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047144 predicted 1144
2 SASI_Rn01_00047145 predicted 475
3 SASI_Rn01_00047146 predicted 919
4 SASI_Rn01_00047148 predicted 206
5 SASI_Rn01_00047149 predicted 1124
6 SASI_Rn01_00047150 predicted 1128
7 SASI_Rn01_00047151 predicted 226
8 SASI_Rn01_00047152 predicted 990
9 SASI_Rn01_00047153 predicted 483
10 SASI_Rn02_00261272 predicted 1048
11 SASI_Rn01_00047147 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048413 predicted 524
2 SASI_Mm01_00048414 predicted 452
3 SASI_Mm01_00048415 predicted 249
4 SASI_Mm01_00048416 predicted 305
5 SASI_Mm01_00048417 predicted 397
6 SASI_Mm01_00048418 predicted 495
7 SASI_Mm01_00048419 predicted 446
8 SASI_Mm01_00048420 predicted 265
9 SASI_Mm01_00048421 predicted 216
10 SASI_Mm01_00048422 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078771 predicted 518
2 SASI_Mm01_00078772 predicted 452
3 SASI_Mm01_00078773 predicted 249
4 SASI_Mm01_00078774 predicted 302
5 SASI_Mm01_00078775 predicted 404
6 SASI_Mm01_00078776 predicted 489
7 SASI_Mm01_00078777 predicted 447
8 SASI_Mm01_00078778 predicted 261
9 SASI_Mm01_00078779 predicted 217
10 SASI_Mm01_00078780 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010685
VALIDATED
LAMP2 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-1191s1c1
Sequence:CCGGGCGTTTCAGATCAACACCTTTCTCGAGAAAGGTGTTGATCTGAAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-823s1c1
Sequence:CCGGCCGTTGGAAACTACAGCATTACTCGAGTAATGCTGTAGTTTCCAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-822s1c1
Sequence:CCGGACCGTTGGAAACTACAGCATTCTCGAGAATGCTGTAGTTTCCAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010685.3-986s1c1
Sequence:CCGGGCTGAACAACAGCCAAATTAACTCGAGTTAATTTGGCTGTTGTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-2556s1c1
Sequence:CCGGGCCCGATACTTAACACATCATCTCGAGATGATGTGTTAAGTATCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010685
VALIDATED
LAMP2 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-1191s1c1
Sequence:CCGGGCGTTTCAGATCAACACCTTTCTCGAGAAAGGTGTTGATCTGAAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-823s1c1
Sequence:CCGGCCGTTGGAAACTACAGCATTACTCGAGTAATGCTGTAGTTTCCAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-822s1c1
Sequence:CCGGACCGTTGGAAACTACAGCATTCTCGAGAATGCTGTAGTTTCCAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010685.3-986s1c1
Sequence:CCGGGCTGAACAACAGCCAAATTAACTCGAGTTAATTTGGCTGTTGTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000086973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-2556s1c1
Sequence:CCGGGCCCGATACTTAACACATCATCTCGAGATGATGTGTTAAGTATCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010685
VALIDATED
LAMP2 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-1191s1c1
Sequence:CCGGGCGTTTCAGATCAACACCTTTCTCGAGAAAGGTGTTGATCTGAAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-823s1c1
Sequence:CCGGCCGTTGGAAACTACAGCATTACTCGAGTAATGCTGTAGTTTCCAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-822s1c1
Sequence:CCGGACCGTTGGAAACTACAGCATTCTCGAGAATGCTGTAGTTTCCAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010685.3-986s1c1
Sequence:CCGGGCTGAACAACAGCCAAATTAACTCGAGTTAATTTGGCTGTTGTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000086973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010685.3-2556s1c1
Sequence:CCGGGCCCGATACTTAACACATCATCTCGAGATGATGTGTTAAGTATCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002294
VALIDATED
LAMP2 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-334s21c1
Sequence:CCGGGTACGCTATGAAACTACAAATCTCGAGATTTGTAGTTTCATAGCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-291s1c1
Sequence:CCGGGTACGCTATGAAACTACAAATCTCGAGATTTGTAGTTTCATAGCGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-561s1c1
Sequence:CCGGGCCATCAGAATTCCATTGAATCTCGAGATTCAATGGAATTCTGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-445s1c1
Sequence:CCGGCCAAGGCAGCATCTACTTATTCTCGAGAATAAGTAGATGCTGCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-1156s1c1
Sequence:CCGGCTGGAGCATTTCAGATAAATACTCGAGTATTTATCTGAAATGCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-1029s1c1
Sequence:CCGGGAAGTGAACATCAGCATGTATCTCGAGATACATGCTGATGTTCACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-1072s21c1
Sequence:CCGGGAAGTGAACATCAGCATGTATCTCGAGATACATGCTGATGTTCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-488s21c1
Sequence:CCGGCCAAGGCAGCATCTACTTATTCTCGAGAATAAGTAGATGCTGCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-604s21c1
Sequence:CCGGGCCATCAGAATTCCATTGAATCTCGAGATTCAATGGAATTCTGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-1199s21c1
Sequence:CCGGCTGGAGCATTTCAGATAAATACTCGAGTATTTATCTGAAATGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002294
VALIDATED
LAMP2 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-334s21c1
Sequence:CCGGGTACGCTATGAAACTACAAATCTCGAGATTTGTAGTTTCATAGCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-291s1c1
Sequence:CCGGGTACGCTATGAAACTACAAATCTCGAGATTTGTAGTTTCATAGCGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-561s1c1
Sequence:CCGGGCCATCAGAATTCCATTGAATCTCGAGATTCAATGGAATTCTGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-445s1c1
Sequence:CCGGCCAAGGCAGCATCTACTTATTCTCGAGAATAAGTAGATGCTGCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-1156s1c1
Sequence:CCGGCTGGAGCATTTCAGATAAATACTCGAGTATTTATCTGAAATGCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-1029s1c1
Sequence:CCGGGAAGTGAACATCAGCATGTATCTCGAGATACATGCTGATGTTCACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-1072s21c1
Sequence:CCGGGAAGTGAACATCAGCATGTATCTCGAGATACATGCTGATGTTCACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-488s21c1
Sequence:CCGGCCAAGGCAGCATCTACTTATTCTCGAGAATAAGTAGATGCTGCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-604s21c1
Sequence:CCGGGCCATCAGAATTCCATTGAATCTCGAGATTCAATGGAATTCTGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-1199s21c1
Sequence:CCGGCTGGAGCATTTCAGATAAATACTCGAGTATTTATCTGAAATGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002294
VALIDATED
LAMP2 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-334s21c1
Sequence:CCGGGTACGCTATGAAACTACAAATCTCGAGATTTGTAGTTTCATAGCGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-291s1c1
Sequence:CCGGGTACGCTATGAAACTACAAATCTCGAGATTTGTAGTTTCATAGCGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-561s1c1
Sequence:CCGGGCCATCAGAATTCCATTGAATCTCGAGATTCAATGGAATTCTGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-445s1c1
Sequence:CCGGCCAAGGCAGCATCTACTTATTCTCGAGAATAAGTAGATGCTGCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-1156s1c1
Sequence:CCGGCTGGAGCATTTCAGATAAATACTCGAGTATTTATCTGAAATGCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002294.1-1029s1c1
Sequence:CCGGGAAGTGAACATCAGCATGTATCTCGAGATACATGCTGATGTTCACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298482    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-1072s21c1
Sequence:CCGGGAAGTGAACATCAGCATGTATCTCGAGATACATGCTGATGTTCACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-488s21c1
Sequence:CCGGCCAAGGCAGCATCTACTTATTCTCGAGAATAAGTAGATGCTGCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-604s21c1
Sequence:CCGGGCCATCAGAATTCCATTGAATCTCGAGATTCAATGGAATTCTGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002294.2-1199s21c1
Sequence:CCGGCTGGAGCATTTCAGATAAATACTCGAGTATTTATCTGAAATGCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)