EMAIL THIS PAGE TO A FRIEND

LAMP3

lysosomal-associated membrane protein 3

178 Gene Product Result for
Synonyms: CD208 DC LAMP DC-LAMP DCLAMP LAMP LAMP-3 TSC403
UniProtKB ID: Q9UQV4, D3DNS4, O94781, Q8NEC8
Gene ID:
Human(27074) Summary: Dendritic cells (DCs) are the most potent antigen-presenting cells. Immature DCs efficiently capture antigens and differentiate into interdigitating dendritic cells (IDCs) in lymphoid tissues that induce primary T-cell responses (summary by de Saint-Vis et al., 1998 [PubMed 9768752]
Mouse(239739) lysosomal-associated membrane protein 3
Rat(303801) lysosomal-associated membrane protein 3
sheep(101103444) lysosomal-associated membrane protein 3
domestic guinea pig(100726502) lysosomal-associated membrane protein 3
naked mole-rat(101725065) lysosomal-associated membrane protein 3
chicken(424961) lysosomal-associated membrane protein 3
cow(531327) lysosomal-associated membrane protein 3
domestic cat(101096666) lysosomal-associated membrane protein 3
dog(607186) lysosomal-associated membrane protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014398 Rosetta Predictions human pricing
NM_001012015 Rosetta Predictions rat pricing
XM_573319 Rosetta Predictions rat pricing
NM_177356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214232 predicted 1079
2 SASI_Hs01_00214233 predicted 1458
3 SASI_Hs01_00214234 predicted 1442
4 SASI_Hs01_00214235 predicted 1401
5 SASI_Hs01_00214236 predicted 444
6 SASI_Hs02_00345584 predicted 429
7 SASI_Hs01_00214237 predicted 948
8 SASI_Hs01_00214238 predicted 314
9 SASI_Hs01_00214240 predicted 884
10 SASI_Hs02_00345585 predicted 894
11 SASI_Hs01_00214231 predicted 1068
12 SASI_Hs01_00214239 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104998 predicted 1057
2 SASI_Rn01_00104999 predicted 800
3 SASI_Rn01_00105000 predicted 410
4 SASI_Rn01_00105001 predicted 259
5 SASI_Rn01_00105002 predicted 1415
6 SASI_Rn01_00105003 predicted 395
7 SASI_Rn01_00105005 predicted 638
8 SASI_Rn01_00105006 predicted 386
9 SASI_Rn01_00105007 predicted 979
10 SASI_Rn02_00200097 predicted 983
11 SASI_Rn01_00105004 predicted 516
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183357 predicted 357
2 SASI_Rn01_00183358 predicted 356
3 SASI_Rn01_00183359 predicted 350
4 SASI_Rn01_00183360 predicted 333
5 SASI_Rn01_00183361 predicted 951
6 SASI_Rn01_00183362 predicted 941
7 SASI_Rn01_00183363 predicted 351
8 SASI_Rn01_00183364 predicted 305
9 SASI_Rn01_00183365 predicted 317
10 SASI_Rn01_00183366 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123156 predicted 382
2 SASI_Mm02_00347502 predicted 1378
3 SASI_Mm02_00347503 predicted 1410
4 SASI_Mm01_00123157 predicted 745
5 SASI_Mm01_00123158 predicted 246
6 SASI_Mm01_00123159 predicted 290
7 SASI_Mm01_00123160 predicted 321
8 SASI_Mm01_00123161 predicted 624
9 SASI_Mm02_00347504 predicted 991
10 SASI_Mm02_00347505 predicted 760
11 SASI_Mm01_00123152 predicted 813
12 SASI_Mm01_00123153 predicted 252
13 SASI_Mm01_00123154 predicted 227
14 SASI_Mm01_00123155 predicted 222
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014398
LAMP3 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014398.2-1114s1c1
Sequence:CCGGGTCTCAGATCCAGAGACAATTCTCGAGAATTGTCTCTGGATCTGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-304s1c1
Sequence:CCGGGCAGCAACAGTACAGGACATACTCGAGTATGTCCTGTACTGTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014398.2-1810s1c1
Sequence:CCGGCCTTGATCTTAACAAAGCCTTCTCGAGAAGGCTTTGTTAAGATCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-388s1c1
Sequence:CCGGGATGGTCATATCACCTTTCAACTCGAGTTGAAAGGTGATATGACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-842s1c1
Sequence:CCGGCGTCAGTCAAGACTGGAATTTCTCGAGAAATTCCAGTCTTGACTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014398.2-843s1c1
Sequence:CCGGGTCAGTCAAGACTGGAATTTACTCGAGTAAATTCCAGTCTTGACTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-1041s1c1
Sequence:CCGGCGGATTTGTGAATCTCACATTCTCGAGAATGTGAGATTCACAAATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014398
LAMP3 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014398.2-1114s1c1
Sequence:CCGGGTCTCAGATCCAGAGACAATTCTCGAGAATTGTCTCTGGATCTGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-304s1c1
Sequence:CCGGGCAGCAACAGTACAGGACATACTCGAGTATGTCCTGTACTGTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014398.2-1810s1c1
Sequence:CCGGCCTTGATCTTAACAAAGCCTTCTCGAGAAGGCTTTGTTAAGATCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-388s1c1
Sequence:CCGGGATGGTCATATCACCTTTCAACTCGAGTTGAAAGGTGATATGACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-842s1c1
Sequence:CCGGCGTCAGTCAAGACTGGAATTTCTCGAGAAATTCCAGTCTTGACTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014398.2-843s1c1
Sequence:CCGGGTCAGTCAAGACTGGAATTTACTCGAGTAAATTCCAGTCTTGACTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-1041s1c1
Sequence:CCGGCGGATTTGTGAATCTCACATTCTCGAGAATGTGAGATTCACAAATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014398
LAMP3 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014398.2-1114s1c1
Sequence:CCGGGTCTCAGATCCAGAGACAATTCTCGAGAATTGTCTCTGGATCTGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-304s1c1
Sequence:CCGGGCAGCAACAGTACAGGACATACTCGAGTATGTCCTGTACTGTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128156    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014398.2-1810s1c1
Sequence:CCGGCCTTGATCTTAACAAAGCCTTCTCGAGAAGGCTTTGTTAAGATCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-388s1c1
Sequence:CCGGGATGGTCATATCACCTTTCAACTCGAGTTGAAAGGTGATATGACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-842s1c1
Sequence:CCGGCGTCAGTCAAGACTGGAATTTCTCGAGAAATTCCAGTCTTGACTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014398.2-843s1c1
Sequence:CCGGGTCAGTCAAGACTGGAATTTACTCGAGTAAATTCCAGTCTTGACTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014398.2-1041s1c1
Sequence:CCGGCGGATTTGTGAATCTCACATTCTCGAGAATGTGAGATTCACAAATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177356
LAMP3 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-743s1c1
Sequence:CCGGGCTCTGTATTAAAGCAGAGATCTCGAGATCTCTGCTTTAATACAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-276s1c1
Sequence:CCGGGCTGCTGAAACTTCAGCCATTCTCGAGAATGGCTGAAGTTTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-243s1c1
Sequence:CCGGGCATCAAGATTCAAGGATGATCTCGAGATCATCCTTGAATCTTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-713s1c1
Sequence:CCGGCGGAACTTATGAAGTCCTAAACTCGAGTTTAGGACTTCATAAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177356.2-1561s1c1
Sequence:CCGGGCCACAATAATTGATTCCAAACTCGAGTTTGGAATCAATTATTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177356
LAMP3 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-743s1c1
Sequence:CCGGGCTCTGTATTAAAGCAGAGATCTCGAGATCTCTGCTTTAATACAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-276s1c1
Sequence:CCGGGCTGCTGAAACTTCAGCCATTCTCGAGAATGGCTGAAGTTTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-243s1c1
Sequence:CCGGGCATCAAGATTCAAGGATGATCTCGAGATCATCCTTGAATCTTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-713s1c1
Sequence:CCGGCGGAACTTATGAAGTCCTAAACTCGAGTTTAGGACTTCATAAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177356.2-1561s1c1
Sequence:CCGGGCCACAATAATTGATTCCAAACTCGAGTTTGGAATCAATTATTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177356
LAMP3 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-743s1c1
Sequence:CCGGGCTCTGTATTAAAGCAGAGATCTCGAGATCTCTGCTTTAATACAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-276s1c1
Sequence:CCGGGCTGCTGAAACTTCAGCCATTCTCGAGAATGGCTGAAGTTTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-243s1c1
Sequence:CCGGGCATCAAGATTCAAGGATGATCTCGAGATCATCCTTGAATCTTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177356.2-713s1c1
Sequence:CCGGCGGAACTTATGAAGTCCTAAACTCGAGTTTAGGACTTCATAAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127279    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177356.2-1561s1c1
Sequence:CCGGGCCACAATAATTGATTCCAAACTCGAGTTTGGAATCAATTATTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)