EMAIL THIS PAGE TO A FRIEND

LAMP5

lysosomal-associated membrane protein family, member 5

119 Gene Product Result for
Synonyms: BAD-LAMP BADLAMP C20orf103 LAMP-5 UNC-43
UniProtKB ID: Q9UJQ1, B4DHZ7, B7Z9Z9
Gene ID:
Mouse(76161) lysosomal-associated membrane protein family, member 5
Rat(362220) lysosomal-associated membrane protein family, member 5
dog(608500) lysosomal-associated membrane protein family, member 5
domestic cat(101090601) lysosomal-associated membrane protein family, member 5
cow(513094) lysosomal-associated membrane protein family, member 5
domestic guinea pig(100728643) lysosomal-associated membrane protein family, member 5
naked mole-rat(101696819) lysosomal-associated membrane protein family, member 5
sheep(101107458) lysosomal-associated membrane protein family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053641 MISSION® esiRNA esiRNA human C20orf103 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012261 Rosetta Predictions human pricing
NM_001014183 Rosetta Predictions rat pricing
NM_029530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078392 predicted 450
2 SASI_Hs01_00078393 predicted 268
3 SASI_Hs01_00078394 predicted 1164
4 SASI_Hs01_00078395 predicted 272
5 SASI_Hs01_00078396 predicted 780
6 SASI_Hs01_00078397 predicted 887
7 SASI_Hs01_00078398 predicted 761
8 SASI_Hs01_00078399 predicted 988
9 SASI_Hs01_00078400 predicted 1316
10 SASI_Hs01_00078401 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065290 predicted 486
2 SASI_Rn01_00065291 predicted 479
3 SASI_Rn01_00065292 predicted 470
4 SASI_Rn02_00201688 predicted 732
5 SASI_Rn02_00201689 predicted 487
6 SASI_Rn01_00065294 predicted 505
7 SASI_Rn01_00065295 predicted 427
8 SASI_Rn01_00065296 predicted 1221
9 SASI_Rn01_00065297 predicted 343
10 SASI_Rn01_00065298 predicted 724
11 SASI_Rn01_00065293 predicted 921
12 SASI_Rn01_00065299 predicted 721
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162697 predicted 573
2 SASI_Mm01_00162698 predicted 561
3 SASI_Mm01_00162699 predicted 562
4 SASI_Mm01_00162700 predicted 788
5 SASI_Mm01_00162701 predicted 435
6 SASI_Mm01_00162702 predicted 1109
7 SASI_Mm01_00162703 predicted 570
8 SASI_Mm01_00162704 predicted 1106
9 SASI_Mm01_00162706 predicted 592
10 SASI_Mm02_00335483 predicted 1024
11 SASI_Mm01_00162705 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012261
LAMP5 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein family, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-893s1c1
Sequence:CCGGGAGCATAAATGCCCAGTGGATCTCGAGATCCACTGGGCATTTATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-683s1c1
Sequence:CCGGCACTTCAAAGACGCAGTCAGTCTCGAGACTGACTGCGTCTTTGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012261.2-1511s1c1
Sequence:CCGGGCACACAGAATACAACCTCATCTCGAGATGAGGTTGTATTCTGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-1045s1c1
Sequence:CCGGCAGATCCCAGTATAAGCACATCTCGAGATGTGCTTATACTGGGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012261.2-1339s1c1
Sequence:CCGGGCTTGGCTTTGACTCTCCAAACTCGAGTTTGGAGAGTCAAAGCCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012261
LAMP5 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein family, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-893s1c1
Sequence:CCGGGAGCATAAATGCCCAGTGGATCTCGAGATCCACTGGGCATTTATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-683s1c1
Sequence:CCGGCACTTCAAAGACGCAGTCAGTCTCGAGACTGACTGCGTCTTTGAAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012261.2-1511s1c1
Sequence:CCGGGCACACAGAATACAACCTCATCTCGAGATGAGGTTGTATTCTGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-1045s1c1
Sequence:CCGGCAGATCCCAGTATAAGCACATCTCGAGATGTGCTTATACTGGGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012261.2-1339s1c1
Sequence:CCGGGCTTGGCTTTGACTCTCCAAACTCGAGTTTGGAGAGTCAAAGCCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012261
LAMP5 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein family, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-893s1c1
Sequence:CCGGGAGCATAAATGCCCAGTGGATCTCGAGATCCACTGGGCATTTATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-683s1c1
Sequence:CCGGCACTTCAAAGACGCAGTCAGTCTCGAGACTGACTGCGTCTTTGAAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012261.2-1511s1c1
Sequence:CCGGGCACACAGAATACAACCTCATCTCGAGATGAGGTTGTATTCTGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012261.2-1045s1c1
Sequence:CCGGCAGATCCCAGTATAAGCACATCTCGAGATGTGCTTATACTGGGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012261.2-1339s1c1
Sequence:CCGGGCTTGGCTTTGACTCTCCAAACTCGAGTTTGGAGAGTCAAAGCCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029530
LAMP5 MISSION shRNA Bacterial Glycerol Stock
lysosomal-associated membrane protein family, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029530.2-1647s1c1
Sequence:CCGGGCTGGCATACTTACACGGTTTCTCGAGAAACCGTGTAAGTATGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-756s1c1
Sequence:CCGGGAAAGTCACAACACTTCCAAACTCGAGTTTGGAAGTGTTGTGACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-607s1c1
Sequence:CCGGCCAGCAATTATGTGGATCTGACTCGAGTCAGATCCACATAATTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-826s1c1
Sequence:CCGGCCTCGGAGAAGACTCACTTTACTCGAGTAAAGTGAGTCTTCTCCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-437s1c1
Sequence:CCGGCCTAATGTTCTTCCATGTAATCTCGAGATTACATGGAAGAACATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029530.2-1308s21c1
Sequence:CCGGATACAGGATCCACCAACATAGCTCGAGCTATGTTGGTGGATCCTGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029530.2-576s21c1
Sequence:CCGGGCCAAATTTATTGTACCTTATCTCGAGATAAGGTACAATAAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029530.2-1018s21c1
Sequence:CCGGTTGATATCATCTCTGACTTTGCTCGAGCAAAGTCAGAGATGATATCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029530.2-1487s21c1
Sequence:CCGGTCTTATTCCTGATGGTTTAATCTCGAGATTAAACCATCAGGAATAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029530
LAMP5 MISSION shRNA shRNA Plasmid DNA
lysosomal-associated membrane protein family, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029530.2-1647s1c1
Sequence:CCGGGCTGGCATACTTACACGGTTTCTCGAGAAACCGTGTAAGTATGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-756s1c1
Sequence:CCGGGAAAGTCACAACACTTCCAAACTCGAGTTTGGAAGTGTTGTGACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-607s1c1
Sequence:CCGGCCAGCAATTATGTGGATCTGACTCGAGTCAGATCCACATAATTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-826s1c1
Sequence:CCGGCCTCGGAGAAGACTCACTTTACTCGAGTAAAGTGAGTCTTCTCCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-437s1c1
Sequence:CCGGCCTAATGTTCTTCCATGTAATCTCGAGATTACATGGAAGAACATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029530.2-1308s21c1
Sequence:CCGGATACAGGATCCACCAACATAGCTCGAGCTATGTTGGTGGATCCTGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029530.2-576s21c1
Sequence:CCGGGCCAAATTTATTGTACCTTATCTCGAGATAAGGTACAATAAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029530.2-1018s21c1
Sequence:CCGGTTGATATCATCTCTGACTTTGCTCGAGCAAAGTCAGAGATGATATCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029530.2-1487s21c1
Sequence:CCGGTCTTATTCCTGATGGTTTAATCTCGAGATTAAACCATCAGGAATAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029530
LAMP5 MISSION shRNA Lentiviral Transduction Particles
lysosomal-associated membrane protein family, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126189    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029530.2-1647s1c1
Sequence:CCGGGCTGGCATACTTACACGGTTTCTCGAGAAACCGTGTAAGTATGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-756s1c1
Sequence:CCGGGAAAGTCACAACACTTCCAAACTCGAGTTTGGAAGTGTTGTGACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-607s1c1
Sequence:CCGGCCAGCAATTATGTGGATCTGACTCGAGTCAGATCCACATAATTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-826s1c1
Sequence:CCGGCCTCGGAGAAGACTCACTTTACTCGAGTAAAGTGAGTCTTCTCCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029530.2-437s1c1
Sequence:CCGGCCTAATGTTCTTCCATGTAATCTCGAGATTACATGGAAGAACATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029530.2-1308s21c1
Sequence:CCGGATACAGGATCCACCAACATAGCTCGAGCTATGTTGGTGGATCCTGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029530.2-576s21c1
Sequence:CCGGGCCAAATTTATTGTACCTTATCTCGAGATAAGGTACAATAAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029530.2-1018s21c1
Sequence:CCGGTTGATATCATCTCTGACTTTGCTCGAGCAAAGTCAGAGATGATATCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029530.2-1487s21c1
Sequence:CCGGTCTTATTCCTGATGGTTTAATCTCGAGATTAAACCATCAGGAATAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)