EMAIL THIS PAGE TO A FRIEND

LAMTOR1

late endosomal/lysosomal adaptor, MAPK and MTOR activator 1

115 Gene Product Result for
Synonyms: C11orf59 PDRO Ragulator1 p18 p27RF-Rho
UniProtKB ID: Q6IAA8, Q8WZ09, Q9NWT0
Gene ID:
Mouse(66508) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Rat(308869) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
sheep(101119502) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
domestic guinea pig(100726527) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
naked mole-rat(101700509) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Zebrafish(100329656) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
domestic cat(101085237) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
cow(614849) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Horse(100052779) ragulator complex protein LAMTOR1
dog(485211) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
chicken(100857186) late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017907 Rosetta Predictions human pricing
NM_199102 Rosetta Predictions rat pricing
NM_025605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156637 predicted 611
2 SASI_Hs01_00156638 predicted 688
3 SASI_Hs01_00156639 predicted 270
4 SASI_Hs01_00156640 predicted 228
5 SASI_Hs01_00156641 predicted 775
6 SASI_Hs01_00156642 predicted 762
7 SASI_Hs01_00156643 predicted 475
8 SASI_Hs01_00156644 predicted 443
9 SASI_Hs01_00156645 predicted 603
10 SASI_Hs01_00156646 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108456 predicted 277
2 SASI_Rn01_00108458 predicted 453
3 SASI_Rn01_00108459 predicted 239
4 SASI_Rn01_00108460 predicted 239
5 SASI_Rn01_00108461 predicted 424
6 SASI_Rn01_00108462 predicted 682
7 SASI_Rn01_00108463 predicted 469
8 SASI_Rn01_00108464 predicted 714
9 SASI_Rn01_00108465 predicted 635
10 SASI_Rn02_00270121 predicted 488
11 SASI_Rn01_00108457 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328627 predicted 663
2 SASI_Mm02_00328628 predicted 250
3 SASI_Mm02_00328629 predicted 702
4 SASI_Mm02_00328630 predicted 662
5 SASI_Mm02_00328631 predicted 243
6 SASI_Mm02_00328632 predicted 238
7 SASI_Mm02_00328633 predicted 245
8 SASI_Mm02_00328634 predicted 465
9 SASI_Mm02_00328635 predicted 286
10 SASI_Mm02_00328636 predicted 250
11 SASI_Mm01_00127736 predicted 821
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017907
VALIDATED
LAMTOR1 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-277s21c1
Sequence:CCGGCATGGAGCAGCATGAGTACATCTCGAGATGTACTCATGCTGCTCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-231s21c1
Sequence:CCGGAGACAGCCAGCAACATCATTGCTCGAGCAATGATGTTGCTGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017907.1-615s1c1
Sequence:CCGGGCGGCTTATACAGTACCCTAACTCGAGTTAGGGTACTGTATAAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017907.1-511s1c1
Sequence:CCGGGCTGGTTGTACAGTTTGGGATCTCGAGATCCCAAACTGTACAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-419s21c1
Sequence:CCGGCCCATCCCGTTCTCTGATTTGCTCGAGCAAATCAGAGAACGGGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017907.1-783s1c1
Sequence:CCGGGTCTTCATAGTCATTGAGAATCTCGAGATTCTCAATGACTATGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-628s21c1
Sequence:CCGGTACCCTAACCTGCTACTAATCCTCGAGGATTAGTAGCAGGTTAGGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-446s21c1
Sequence:CCGGGTCTCCAGGATAGCTGCTTATCTCGAGATAAGCAGCTATCCTGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017907
VALIDATED
LAMTOR1 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-277s21c1
Sequence:CCGGCATGGAGCAGCATGAGTACATCTCGAGATGTACTCATGCTGCTCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-231s21c1
Sequence:CCGGAGACAGCCAGCAACATCATTGCTCGAGCAATGATGTTGCTGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017907.1-615s1c1
Sequence:CCGGGCGGCTTATACAGTACCCTAACTCGAGTTAGGGTACTGTATAAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017907.1-511s1c1
Sequence:CCGGGCTGGTTGTACAGTTTGGGATCTCGAGATCCCAAACTGTACAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-419s21c1
Sequence:CCGGCCCATCCCGTTCTCTGATTTGCTCGAGCAAATCAGAGAACGGGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017907.1-783s1c1
Sequence:CCGGGTCTTCATAGTCATTGAGAATCTCGAGATTCTCAATGACTATGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-628s21c1
Sequence:CCGGTACCCTAACCTGCTACTAATCCTCGAGGATTAGTAGCAGGTTAGGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-446s21c1
Sequence:CCGGGTCTCCAGGATAGCTGCTTATCTCGAGATAAGCAGCTATCCTGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017907
VALIDATED
LAMTOR1 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-277s21c1
Sequence:CCGGCATGGAGCAGCATGAGTACATCTCGAGATGTACTCATGCTGCTCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-231s21c1
Sequence:CCGGAGACAGCCAGCAACATCATTGCTCGAGCAATGATGTTGCTGGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172636    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017907.1-615s1c1
Sequence:CCGGGCGGCTTATACAGTACCCTAACTCGAGTTAGGGTACTGTATAAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017907.1-511s1c1
Sequence:CCGGGCTGGTTGTACAGTTTGGGATCTCGAGATCCCAAACTGTACAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-419s21c1
Sequence:CCGGCCCATCCCGTTCTCTGATTTGCTCGAGCAAATCAGAGAACGGGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017907.1-783s1c1
Sequence:CCGGGTCTTCATAGTCATTGAGAATCTCGAGATTCTCAATGACTATGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-628s21c1
Sequence:CCGGTACCCTAACCTGCTACTAATCCTCGAGGATTAGTAGCAGGTTAGGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_017907.1-446s21c1
Sequence:CCGGGTCTCCAGGATAGCTGCTTATCTCGAGATAAGCAGCTATCCTGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025605
LAMTOR1 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025605.1-657s1c1
Sequence:CCGGCCTGCTACTAATCACGGAGAACTCGAGTTCTCCGTGATTAGTAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-520s1c1
Sequence:CCGGGCGAAAGAAGAGCTGGTTGTACTCGAGTACAACCAGCTCTTCTTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-482s1c1
Sequence:CCGGCGTATGCCTATAGTGCACTTTCTCGAGAAAGTGCACTATAGGCATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-185s1c1
Sequence:CCGGCCAACTACCATAGCCTACCTTCTCGAGAAGGTAGGCTATGGTAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-226s1c1
Sequence:CCGGGCCCTGCTTTCCTCCATCCTTCTCGAGAAGGATGGAGGAAAGCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025605
LAMTOR1 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025605.1-657s1c1
Sequence:CCGGCCTGCTACTAATCACGGAGAACTCGAGTTCTCCGTGATTAGTAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-520s1c1
Sequence:CCGGGCGAAAGAAGAGCTGGTTGTACTCGAGTACAACCAGCTCTTCTTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-482s1c1
Sequence:CCGGCGTATGCCTATAGTGCACTTTCTCGAGAAAGTGCACTATAGGCATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-185s1c1
Sequence:CCGGCCAACTACCATAGCCTACCTTCTCGAGAAGGTAGGCTATGGTAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-226s1c1
Sequence:CCGGGCCCTGCTTTCCTCCATCCTTCTCGAGAAGGATGGAGGAAAGCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025605
LAMTOR1 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121342    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025605.1-657s1c1
Sequence:CCGGCCTGCTACTAATCACGGAGAACTCGAGTTCTCCGTGATTAGTAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-520s1c1
Sequence:CCGGGCGAAAGAAGAGCTGGTTGTACTCGAGTACAACCAGCTCTTCTTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-482s1c1
Sequence:CCGGCGTATGCCTATAGTGCACTTTCTCGAGAAAGTGCACTATAGGCATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-185s1c1
Sequence:CCGGCCAACTACCATAGCCTACCTTCTCGAGAAGGTAGGCTATGGTAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025605.1-226s1c1
Sequence:CCGGGCCCTGCTTTCCTCCATCCTTCTCGAGAAGGATGGAGGAAAGCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)