EMAIL THIS PAGE TO A FRIEND

LAMTOR2

late endosomal/lysosomal adaptor, MAPK and MTOR activator 2

50 Gene Product Result for
Synonyms: ENDAP HSPC003 MAPBPIP MAPKSP1AP ROBLD3 Ragulator2 p14
UniProtKB ID: Q9Y2Q5, Q5VY97, Q5VY98, Q5VY99
Gene ID:
Human(28956) Summary: The product of this gene is highly conserved with a mouse protein associated with the cytoplasmic face of late endosomes and lysosomes. The mouse protein interacts with MAPK scaffold protein 1, a component of the mitogen-activated protein kinase pathway. In humans, a mutation in this gene has been associated with a primary immunodeficiency syndrome, and suggests a role for this protein in endosomal biogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(83409) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Rat(295234) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Zebrafish(445155) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
domestic cat(101084677) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
cow(616375) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
dog(480125) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
domestic guinea pig(100720456) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
naked mole-rat(101703739) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
sheep(101122907) late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014017 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014017 Rosetta Predictions human pricing
NM_001106441 Rosetta Predictions rat pricing
NM_031248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089019 predicted 254
2 SASI_Hs01_00089020 predicted 306
3 SASI_Hs01_00089021 predicted 202
4 SASI_Hs01_00089022 predicted 243
5 SASI_Hs01_00089023 predicted 263
6 SASI_Hs01_00089024 predicted 211
7 SASI_Hs01_00089025 predicted 331
8 SASI_Hs02_00344989 predicted 250
9 SASI_Hs01_00089026 predicted 204
10 SASI_Hs01_00089027 predicted 359
11 SASI_Hs01_00089028 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106441 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218988 predicted 334
2 SASI_Rn02_00218989 predicted 250
3 SASI_Rn02_00218990 predicted 208
4 SASI_Rn02_00218991 predicted 274
5 SASI_Rn02_00218992 predicted 323
6 SASI_Rn02_00218993 predicted 229
7 SASI_Rn02_00218994 predicted 239
8 SASI_Rn02_00218995 predicted 199
9 SASI_Rn02_00218996 predicted 256
10 SASI_Rn02_00218997 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00337065 predicted 262
2 SASI_Mm01_00071264 predicted 219
3 SASI_Mm02_00337066 predicted 301
4 SASI_Mm01_00071268 predicted 218
5 SASI_Mm02_00337067 predicted 256
6 SASI_Mm02_00337068 predicted 310
7 SASI_Mm02_00337069 predicted 298
8 SASI_Mm02_00337070 predicted 305
9 SASI_Mm02_00337071 predicted 240
10 SASI_Mm01_00071263 predicted 323
11 SASI_Mm01_00071265 predicted 324
12 SASI_Mm01_00071266 predicted 325
13 SASI_Mm01_00071267 predicted 257
14 SASI_Mm01_00071269 predicted 238
15 SASI_Mm01_00071270 predicted 322
16 SASI_Mm01_00071271 predicted 255
17 SASI_Mm01_00071272 predicted 292
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031248
VALIDATED
LAMTOR2 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-364s1c1
Sequence:CCGGCTTCGGAATGCTCAAGGCTAACTCGAGTTAGCCTTGAGCATTCCGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-325s1c1
Sequence:CCGGCAACCTTCTGCTATGTATGTACTCGAGTACATACATAGCAGAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-265s1c1
Sequence:CCGGCAGTCTCAAATTTATCCTGATCTCGAGATCAGGATAAATTTGAGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031248.3-136s1c1
Sequence:CCGGGCTGAATAATGAGGGATCGCTCTCGAGAGCGATCCCTCATTATTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-133s1c1
Sequence:CCGGGCTGCTGAATAATGAGGGATCCTCGAGGATCCCTCATTATTCAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-364s21c1
Sequence:CCGGCTTCGGAATGCTCAAGGCTAACTCGAGTTAGCCTTGAGCATTCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-133s21c1
Sequence:CCGGGCTGCTGAATAATGAGGGATCCTCGAGGATCCCTCATTATTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-325s21c1
Sequence:CCGGCAACCTTCTGCTATGTATGTACTCGAGTACATACATAGCAGAAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-265s21c1
Sequence:CCGGCAGTCTCAAATTTATCCTGATCTCGAGATCAGGATAAATTTGAGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031248
VALIDATED
LAMTOR2 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-364s1c1
Sequence:CCGGCTTCGGAATGCTCAAGGCTAACTCGAGTTAGCCTTGAGCATTCCGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-325s1c1
Sequence:CCGGCAACCTTCTGCTATGTATGTACTCGAGTACATACATAGCAGAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-265s1c1
Sequence:CCGGCAGTCTCAAATTTATCCTGATCTCGAGATCAGGATAAATTTGAGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031248.3-136s1c1
Sequence:CCGGGCTGAATAATGAGGGATCGCTCTCGAGAGCGATCCCTCATTATTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-133s1c1
Sequence:CCGGGCTGCTGAATAATGAGGGATCCTCGAGGATCCCTCATTATTCAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-364s21c1
Sequence:CCGGCTTCGGAATGCTCAAGGCTAACTCGAGTTAGCCTTGAGCATTCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-133s21c1
Sequence:CCGGGCTGCTGAATAATGAGGGATCCTCGAGGATCCCTCATTATTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000292656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-325s21c1
Sequence:CCGGCAACCTTCTGCTATGTATGTACTCGAGTACATACATAGCAGAAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-265s21c1
Sequence:CCGGCAGTCTCAAATTTATCCTGATCTCGAGATCAGGATAAATTTGAGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031248
VALIDATED
LAMTOR2 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-364s1c1
Sequence:CCGGCTTCGGAATGCTCAAGGCTAACTCGAGTTAGCCTTGAGCATTCCGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-325s1c1
Sequence:CCGGCAACCTTCTGCTATGTATGTACTCGAGTACATACATAGCAGAAGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-265s1c1
Sequence:CCGGCAGTCTCAAATTTATCCTGATCTCGAGATCAGGATAAATTTGAGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031248.3-136s1c1
Sequence:CCGGGCTGAATAATGAGGGATCGCTCTCGAGAGCGATCCCTCATTATTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031248.3-133s1c1
Sequence:CCGGGCTGCTGAATAATGAGGGATCCTCGAGGATCCCTCATTATTCAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-364s21c1
Sequence:CCGGCTTCGGAATGCTCAAGGCTAACTCGAGTTAGCCTTGAGCATTCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-133s21c1
Sequence:CCGGGCTGCTGAATAATGAGGGATCCTCGAGGATCCCTCATTATTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000292656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-325s21c1
Sequence:CCGGCAACCTTCTGCTATGTATGTACTCGAGTACATACATAGCAGAAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031248.3-265s21c1
Sequence:CCGGCAGTCTCAAATTTATCCTGATCTCGAGATCAGGATAAATTTGAGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014017
LAMTOR2 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-157s1c1
Sequence:CCGGCGAGGGATCACTGCTGGCCTACTCGAGTAGGCCAGCAGTGATCCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-250s1c1
Sequence:CCGGGAACGGGAACCAAGCGTTTAACTCGAGTTAAACGCTTGGTTCCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-370s1c1
Sequence:CCGGCGTGGGCTTTGGAATGCTCAACTCGAGTTGAGCATTCCAAAGCCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-260s1c1
Sequence:CCGGCAAGCGTTTAATGAAGACAATCTCGAGATTGTCTTCATTAAACGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014017.1-253s1c1
Sequence:CCGGCGGGAACCAAGCGTTTAATGACTCGAGTCATTAAACGCTTGGTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-211s1c1
Sequence:CCGGCGCTGCCATAGCCAGTAACATCTCGAGATGTTACTGGCTATGGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-338s21c1
Sequence:CCGGGAACGGGAACCAAGCGTTTAACTCGAGTTAAACGCTTGGTTCCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-245s21c1
Sequence:CCGGCGAGGGATCACTGCTGGCCTACTCGAGTAGGCCAGCAGTGATCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-522s21c1
Sequence:CCGGACCCAAGTGGCGGCATCTTAACTCGAGTTAAGATGCCGCCACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-223s21c1
Sequence:CCGGAGAGCACCCTGCTGCTGAATACTCGAGTATTCAGCAGCAGGGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-348s21c1
Sequence:CCGGCAAGCGTTTAATGAAGACAATCTCGAGATTGTCTTCATTAAACGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014017
LAMTOR2 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-157s1c1
Sequence:CCGGCGAGGGATCACTGCTGGCCTACTCGAGTAGGCCAGCAGTGATCCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-250s1c1
Sequence:CCGGGAACGGGAACCAAGCGTTTAACTCGAGTTAAACGCTTGGTTCCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-370s1c1
Sequence:CCGGCGTGGGCTTTGGAATGCTCAACTCGAGTTGAGCATTCCAAAGCCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-260s1c1
Sequence:CCGGCAAGCGTTTAATGAAGACAATCTCGAGATTGTCTTCATTAAACGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014017.1-253s1c1
Sequence:CCGGCGGGAACCAAGCGTTTAATGACTCGAGTCATTAAACGCTTGGTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-211s1c1
Sequence:CCGGCGCTGCCATAGCCAGTAACATCTCGAGATGTTACTGGCTATGGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-338s21c1
Sequence:CCGGGAACGGGAACCAAGCGTTTAACTCGAGTTAAACGCTTGGTTCCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-245s21c1
Sequence:CCGGCGAGGGATCACTGCTGGCCTACTCGAGTAGGCCAGCAGTGATCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-522s21c1
Sequence:CCGGACCCAAGTGGCGGCATCTTAACTCGAGTTAAGATGCCGCCACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-223s21c1
Sequence:CCGGAGAGCACCCTGCTGCTGAATACTCGAGTATTCAGCAGCAGGGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-348s21c1
Sequence:CCGGCAAGCGTTTAATGAAGACAATCTCGAGATTGTCTTCATTAAACGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014017
LAMTOR2 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-157s1c1
Sequence:CCGGCGAGGGATCACTGCTGGCCTACTCGAGTAGGCCAGCAGTGATCCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-250s1c1
Sequence:CCGGGAACGGGAACCAAGCGTTTAACTCGAGTTAAACGCTTGGTTCCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-370s1c1
Sequence:CCGGCGTGGGCTTTGGAATGCTCAACTCGAGTTGAGCATTCCAAAGCCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-260s1c1
Sequence:CCGGCAAGCGTTTAATGAAGACAATCTCGAGATTGTCTTCATTAAACGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014017.1-253s1c1
Sequence:CCGGCGGGAACCAAGCGTTTAATGACTCGAGTCATTAAACGCTTGGTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014017.1-211s1c1
Sequence:CCGGCGCTGCCATAGCCAGTAACATCTCGAGATGTTACTGGCTATGGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-338s21c1
Sequence:CCGGGAACGGGAACCAAGCGTTTAACTCGAGTTAAACGCTTGGTTCCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-245s21c1
Sequence:CCGGCGAGGGATCACTGCTGGCCTACTCGAGTAGGCCAGCAGTGATCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-522s21c1
Sequence:CCGGACCCAAGTGGCGGCATCTTAACTCGAGTTAAGATGCCGCCACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-223s21c1
Sequence:CCGGAGAGCACCCTGCTGCTGAATACTCGAGTATTCAGCAGCAGGGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014017.3-348s21c1
Sequence:CCGGCAAGCGTTTAATGAAGACAATCTCGAGATTGTCTTCATTAAACGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)