EMAIL THIS PAGE TO A FRIEND

LAMTOR3

late endosomal/lysosomal adaptor, MAPK and MTOR activator 3

92 Gene Product Result for
Synonyms: MAP2K1IP1 MAPBP MAPKSP1 MP1 PRO0633 Ragulator3
UniProtKB ID: Q9UHA4, B2R4A1, J3KMX4, Q9H364
Gene ID:
Human(8649) Summary: This gene encodes a scaffold protein that functions in the extracellular signal-regulated kinase (ERK) cascade. The protein is localized to late endosomes by the mitogen-activated protein-binding protein-interacting protein, and binds specifically to MAP kinase kinase MAP2K1/MEK1, MAP kinase MAPK3/ERK1, and MAP kinase MAPK1/ERK2. Studies of the orthologous gene in mouse indicate that it regulates late endosomal traffic and cell proliferation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 13. [provided by RefSeq, Aug 2011]
Mouse(56692) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Rat(362045) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
sheep(101110413) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
domestic guinea pig(100727855) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
naked mole-rat(101702297) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Zebrafish(553597) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
cow(533155) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
domestic cat(101099376) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
dog(478492) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
chicken(425210) late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021970 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106201 MISSION® esiRNA esiRNA human MAP2K1IP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021970 Rosetta Predictions human pricing
NM_001008375 Rosetta Predictions rat pricing
NM_019920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208193 predicted 572
2 SASI_Hs02_00355321 predicted 430
3 SASI_Hs01_00208195 predicted 484
4 SASI_Hs01_00208197 predicted 498
5 SASI_Hs02_00355322 predicted 627
6 SASI_Hs01_00208198 predicted 448
7 SASI_Hs01_00208200 predicted 639
8 SASI_Hs01_00208201 predicted 591
9 SASI_Hs02_00355323 predicted 673
10 SASI_Hs02_00355324 predicted 261
11 SASI_Hs01_00208194 predicted 551
12 SASI_Hs01_00208196 predicted 605
13 SASI_Hs01_00208199 predicted 611
14 SASI_Hs01_00208202 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074905 predicted 853
2 SASI_Rn01_00074906 predicted 841
3 SASI_Rn01_00074907 predicted 625
4 SASI_Rn01_00074908 predicted 399
5 SASI_Rn01_00074909 predicted 638
6 SASI_Rn01_00074910 predicted 207
7 SASI_Rn02_00199150 predicted 363
8 SASI_Rn01_00074911 predicted 703
9 SASI_Rn01_00074912 predicted 613
10 SASI_Rn01_00074914 predicted 883
11 SASI_Rn01_00074913 predicted 558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131040 predicted 645
2 SASI_Mm01_00131042 predicted 477
3 SASI_Mm01_00131043 predicted 765
4 SASI_Mm02_00325196 predicted 321
5 SASI_Mm01_00131044 predicted 739
6 SASI_Mm01_00131045 predicted 199
7 SASI_Mm01_00131046 predicted 235
8 SASI_Mm01_00131047 predicted 901
9 SASI_Mm01_00131048 predicted 780
10 SASI_Mm01_00131049 predicted 704
11 SASI_Mm01_00131041 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019920
VALIDATED
LAMTOR3 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-381s21c1
Sequence:CCGGCAGGTGGTTCAGTTCAATCGTCTCGAGACGATTGAACTGAACCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-359s21c1
Sequence:CCGGCATCTGCTACTATAACACCTACTCGAGTAGGTGTTATAGTAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-204s21c1
Sequence:CCGGCATGCAATTGTTGTGTCAGATCTCGAGATCTGACACAACAATTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-436s21c1
Sequence:CCGGGTGCCAACACAGGACTAATTGCTCGAGCAATTAGTCCTGTGTTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019920.1-588s1c1
Sequence:CCGGCCGACCACAATAGTACTTGTACTCGAGTACAAGTACTATTGTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019920.1-480s1c1
Sequence:CCGGCCGTTATTTGAAGAACTGATACTCGAGTATCAGTTCTTCAAATAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019920.1-359s1c1
Sequence:CCGGCATCTGCTACTATAACACCTACTCGAGTAGGTGTTATAGTAGCAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019920.1-204s1c1
Sequence:CCGGCATGCAATTGTTGTGTCAGATCTCGAGATCTGACACAACAATTGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019920.1-381s1c1
Sequence:CCGGCAGGTGGTTCAGTTCAATCGTCTCGAGACGATTGAACTGAACCACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019920.2-648s21c1
Sequence:CCGGAGAAGAGCCTATTGCTATAATCTCGAGATTATAGCAATAGGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019920
VALIDATED
LAMTOR3 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-381s21c1
Sequence:CCGGCAGGTGGTTCAGTTCAATCGTCTCGAGACGATTGAACTGAACCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-359s21c1
Sequence:CCGGCATCTGCTACTATAACACCTACTCGAGTAGGTGTTATAGTAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-204s21c1
Sequence:CCGGCATGCAATTGTTGTGTCAGATCTCGAGATCTGACACAACAATTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-436s21c1
Sequence:CCGGGTGCCAACACAGGACTAATTGCTCGAGCAATTAGTCCTGTGTTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019920.1-588s1c1
Sequence:CCGGCCGACCACAATAGTACTTGTACTCGAGTACAAGTACTATTGTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019920.1-480s1c1
Sequence:CCGGCCGTTATTTGAAGAACTGATACTCGAGTATCAGTTCTTCAAATAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019920.1-359s1c1
Sequence:CCGGCATCTGCTACTATAACACCTACTCGAGTAGGTGTTATAGTAGCAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019920.1-204s1c1
Sequence:CCGGCATGCAATTGTTGTGTCAGATCTCGAGATCTGACACAACAATTGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019920.1-381s1c1
Sequence:CCGGCAGGTGGTTCAGTTCAATCGTCTCGAGACGATTGAACTGAACCACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019920.2-648s21c1
Sequence:CCGGAGAAGAGCCTATTGCTATAATCTCGAGATTATAGCAATAGGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019920
VALIDATED
LAMTOR3 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-381s21c1
Sequence:CCGGCAGGTGGTTCAGTTCAATCGTCTCGAGACGATTGAACTGAACCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-359s21c1
Sequence:CCGGCATCTGCTACTATAACACCTACTCGAGTAGGTGTTATAGTAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-204s21c1
Sequence:CCGGCATGCAATTGTTGTGTCAGATCTCGAGATCTGACACAACAATTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019920.2-436s21c1
Sequence:CCGGGTGCCAACACAGGACTAATTGCTCGAGCAATTAGTCCTGTGTTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088848    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019920.1-588s1c1
Sequence:CCGGCCGACCACAATAGTACTTGTACTCGAGTACAAGTACTATTGTGGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019920.1-480s1c1
Sequence:CCGGCCGTTATTTGAAGAACTGATACTCGAGTATCAGTTCTTCAAATAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019920.1-359s1c1
Sequence:CCGGCATCTGCTACTATAACACCTACTCGAGTAGGTGTTATAGTAGCAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019920.1-204s1c1
Sequence:CCGGCATGCAATTGTTGTGTCAGATCTCGAGATCTGACACAACAATTGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019920.1-381s1c1
Sequence:CCGGCAGGTGGTTCAGTTCAATCGTCTCGAGACGATTGAACTGAACCACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019920.2-648s21c1
Sequence:CCGGAGAAGAGCCTATTGCTATAATCTCGAGATTATAGCAATAGGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021970
VALIDATED
LAMTOR3 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021970.3-415s21c1
Sequence:CCGGGCAACAGACCAAGGAAGCAAACTCGAGTTTGCTTCCTTGGTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-577s21c1
Sequence:CCGGCTTGCTCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-536s21c1
Sequence:CCGGGCAGTGCCAATACAGGACTAACTCGAGTTAGTCCTGTATTGGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-672s21c1
Sequence:CCGGATATCAATCCAGCAATCTTTACTCGAGTAAAGATTGCTGGATTGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-748s21c1
Sequence:GTACCGGATACTAAAGAGCTAGCATATACTCGAGTATATGCTAGCTCTTTAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021970.2-340s1c1
Sequence:CCGGCCTGTTATTAAAGTGGCAAATCTCGAGATTTGCCACTTTAATAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-536s1c1
Sequence:CCGGGCAGTGCCAATACAGGACTAACTCGAGTTAGTCCTGTATTGGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021970.2-599s1c1
Sequence:CCGGTGAGACAAGTTGTGGAAGTTTCTCGAGAAACTTCCACAACTTGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-577s1c1
Sequence:CCGGCTTGCTCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-415s1c1
Sequence:CCGGGCAACAGACCAAGGAAGCAAACTCGAGTTTGCTTCCTTGGTCTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-487s21c1
Sequence:CCGGGTGGTTCAATTTAATCGTTTACTCGAGTAAACGATTAAATTGAACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021970
VALIDATED
LAMTOR3 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021970.3-415s21c1
Sequence:CCGGGCAACAGACCAAGGAAGCAAACTCGAGTTTGCTTCCTTGGTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-577s21c1
Sequence:CCGGCTTGCTCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-536s21c1
Sequence:CCGGGCAGTGCCAATACAGGACTAACTCGAGTTAGTCCTGTATTGGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-672s21c1
Sequence:CCGGATATCAATCCAGCAATCTTTACTCGAGTAAAGATTGCTGGATTGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-748s21c1
Sequence:GTACCGGATACTAAAGAGCTAGCATATACTCGAGTATATGCTAGCTCTTTAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021970.2-340s1c1
Sequence:CCGGCCTGTTATTAAAGTGGCAAATCTCGAGATTTGCCACTTTAATAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-536s1c1
Sequence:CCGGGCAGTGCCAATACAGGACTAACTCGAGTTAGTCCTGTATTGGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021970.2-599s1c1
Sequence:CCGGTGAGACAAGTTGTGGAAGTTTCTCGAGAAACTTCCACAACTTGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-577s1c1
Sequence:CCGGCTTGCTCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-415s1c1
Sequence:CCGGGCAACAGACCAAGGAAGCAAACTCGAGTTTGCTTCCTTGGTCTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-487s21c1
Sequence:CCGGGTGGTTCAATTTAATCGTTTACTCGAGTAAACGATTAAATTGAACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021970
VALIDATED
LAMTOR3 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021970.3-415s21c1
Sequence:CCGGGCAACAGACCAAGGAAGCAAACTCGAGTTTGCTTCCTTGGTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-577s21c1
Sequence:CCGGCTTGCTCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-536s21c1
Sequence:CCGGGCAGTGCCAATACAGGACTAACTCGAGTTAGTCCTGTATTGGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-672s21c1
Sequence:CCGGATATCAATCCAGCAATCTTTACTCGAGTAAAGATTGCTGGATTGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-748s21c1
Sequence:GTACCGGATACTAAAGAGCTAGCATATACTCGAGTATATGCTAGCTCTTTAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021970.2-340s1c1
Sequence:CCGGCCTGTTATTAAAGTGGCAAATCTCGAGATTTGCCACTTTAATAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-536s1c1
Sequence:CCGGGCAGTGCCAATACAGGACTAACTCGAGTTAGTCCTGTATTGGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021970.2-599s1c1
Sequence:CCGGTGAGACAAGTTGTGGAAGTTTCTCGAGAAACTTCCACAACTTGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-577s1c1
Sequence:CCGGCTTGCTCCATTGTTTGAAGAACTCGAGTTCTTCAAACAATGGAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_021970.2-415s1c1
Sequence:CCGGGCAACAGACCAAGGAAGCAAACTCGAGTTTGCTTCCTTGGTCTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_021970.3-487s21c1
Sequence:CCGGGTGGTTCAATTTAATCGTTTACTCGAGTAAACGATTAAATTGAACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)