EMAIL THIS PAGE TO A FRIEND

LAMTOR4

late endosomal/lysosomal adaptor, MAPK and MTOR activator 4

57 Gene Product Result for
Synonyms: C7orf59
UniProtKB ID: Q0VGL1
Gene ID:
Mouse(66096) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Rat(360776) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
cow(511903) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
dog(479736) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
domestic cat(101089667) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
domestic guinea pig(100717094) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
naked mole-rat(101722953) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
sheep(101106991) late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107058 Anti-Lamtor4 antibody produced in rabbit affinity isolated antibody mouse, human, rabbit, guinea pig
western blot pricing
HPA020998 Anti-LAMTOR4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008395 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008395 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008395 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU057661 MISSION® esiRNA esiRNA human C7orf59 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008395 Rosetta Predictions human pricing
NM_001108330 Rosetta Predictions rat pricing
NM_001081108 Rosetta Predictions mouse pricing
XM_132434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008395 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305429 predicted 257
2 SASI_Hs02_00305430 predicted 300
3 SASI_Hs02_00305431 predicted 306
4 SASI_Hs01_00241006 predicted 238
5 SASI_Hs02_00305432 predicted 380
6 SASI_Hs02_00305433 predicted 386
7 SASI_Hs02_00305434 predicted 303
8 SASI_Hs01_00241008 predicted 287
9 SASI_Hs01_00241009 predicted 227
10 SASI_Hs01_00241010 predicted 246
11 SASI_Hs01_00241007 predicted 337
12 SASI_Hs01_00241011 predicted 330
13 SASI_Hs01_00241012 predicted 300
14 SASI_Hs01_00241013 predicted 230
15 SASI_Hs01_00241014 predicted 332
16 SASI_Hs01_00241015 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237599 predicted 338
2 SASI_Rn02_00237600 predicted 348
3 SASI_Rn02_00237601 predicted 254
4 SASI_Rn02_00237602 predicted 335
5 SASI_Rn02_00237603 predicted 233
6 SASI_Rn02_00237604 predicted 343
7 SASI_Rn02_00237605 predicted 227
8 SASI_Rn02_00237606 predicted 352
9 SASI_Rn02_00237607 predicted 342
10 SASI_Rn02_00237608 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295261 predicted 355
2 SASI_Mm02_00295262 predicted 310
3 SASI_Mm02_00295263 predicted 237
4 SASI_Mm02_00295264 predicted 293
5 SASI_Mm02_00295265 predicted 330
6 SASI_Mm02_00295266 predicted 334
7 SASI_Mm02_00295267 predicted 248
8 SASI_Mm02_00295268 predicted 342
9 SASI_Mm02_00295269 predicted 241
10 SASI_Mm02_00295270 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00250930 predicted 353
2 SASI_Mm01_00250931 predicted 311
3 SASI_Mm01_00250932 predicted 246
4 SASI_Mm01_00250933 predicted 296
5 SASI_Mm01_00250934 predicted 344
6 SASI_Mm01_00250935 predicted 338
7 SASI_Mm01_00250936 predicted 254
8 SASI_Mm01_00250937 predicted 353
9 SASI_Mm01_00250938 predicted 239
10 SASI_Mm01_00250939 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008395
VALIDATED
LAMTOR4 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008395.1-306s1c1
Sequence:CCGGGTTTGTGGTGAAGAGGCAGAACTCGAGTTCTGCCTCTTCACCACAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008395.1-510s1c1
Sequence:CCGGGAGCTGTGTTAAGGAGAACAACTCGAGTTGTTCTCCTTAACACAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-302s21c1
Sequence:CCGGTGTCAGGACAGAGGGTGTTTGCTCGAGCAAACACCCTCTGTCCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-237s21c1
Sequence:CCGGCGGCATGAATGTGCCCTTCAACTCGAGTTGAAGGGCACATTCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-117s21c1
Sequence:CCGGCTACCTGGTACTGAGTGAAGGCTCGAGCCTTCACTCAGTACCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-264s21c1
Sequence:CCGGGTCTGTGGTCTTTGGAGAACACTCGAGTGTTCTCCAAAGACCACAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-440s21c1
Sequence:CCGGGTCTTGGCTTGCTGCTAGAACCTCGAGGTTCTAGCAGCAAGCCAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008395
VALIDATED
LAMTOR4 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008395.1-306s1c1
Sequence:CCGGGTTTGTGGTGAAGAGGCAGAACTCGAGTTCTGCCTCTTCACCACAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008395.1-510s1c1
Sequence:CCGGGAGCTGTGTTAAGGAGAACAACTCGAGTTGTTCTCCTTAACACAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-302s21c1
Sequence:CCGGTGTCAGGACAGAGGGTGTTTGCTCGAGCAAACACCCTCTGTCCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-237s21c1
Sequence:CCGGCGGCATGAATGTGCCCTTCAACTCGAGTTGAAGGGCACATTCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-117s21c1
Sequence:CCGGCTACCTGGTACTGAGTGAAGGCTCGAGCCTTCACTCAGTACCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-264s21c1
Sequence:CCGGGTCTGTGGTCTTTGGAGAACACTCGAGTGTTCTCCAAAGACCACAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-440s21c1
Sequence:CCGGGTCTTGGCTTGCTGCTAGAACCTCGAGGTTCTAGCAGCAAGCCAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008395
VALIDATED
LAMTOR4 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180363    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008395.1-306s1c1
Sequence:CCGGGTTTGTGGTGAAGAGGCAGAACTCGAGTTCTGCCTCTTCACCACAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179698    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008395.1-510s1c1
Sequence:CCGGGAGCTGTGTTAAGGAGAACAACTCGAGTTGTTCTCCTTAACACAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-302s21c1
Sequence:CCGGTGTCAGGACAGAGGGTGTTTGCTCGAGCAAACACCCTCTGTCCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-237s21c1
Sequence:CCGGCGGCATGAATGTGCCCTTCAACTCGAGTTGAAGGGCACATTCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-117s21c1
Sequence:CCGGCTACCTGGTACTGAGTGAAGGCTCGAGCCTTCACTCAGTACCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-264s21c1
Sequence:CCGGGTCTGTGGTCTTTGGAGAACACTCGAGTGTTCTCCAAAGACCACAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001008395.2-440s21c1
Sequence:CCGGGTCTTGGCTTGCTGCTAGAACCTCGAGGTTCTAGCAGCAAGCCAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081108
VALIDATED
LAMTOR4 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-233s21c1
Sequence:CCGGTTGCACCATGGCACGAACATCCTCGAGGATGTTCGTGCCATGGTGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-444s21c1
Sequence:CCGGTACCACCTTCTGCTGTCCTTGCTCGAGCAAGGACAGCAGAAGGTGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-306s21c1
Sequence:CCGGTGTCAGGACAGAGGGTGTTTGCTCGAGCAAACACCCTCTGTCCTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-358s21c1
Sequence:CCGGTATTGATGTCTGAGCTATAAACTCGAGTTTATAGCTCAGACATCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081108
VALIDATED
LAMTOR4 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-233s21c1
Sequence:CCGGTTGCACCATGGCACGAACATCCTCGAGGATGTTCGTGCCATGGTGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-444s21c1
Sequence:CCGGTACCACCTTCTGCTGTCCTTGCTCGAGCAAGGACAGCAGAAGGTGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-306s21c1
Sequence:CCGGTGTCAGGACAGAGGGTGTTTGCTCGAGCAAACACCCTCTGTCCTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-358s21c1
Sequence:CCGGTATTGATGTCTGAGCTATAAACTCGAGTTTATAGCTCAGACATCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081108
VALIDATED
LAMTOR4 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-233s21c1
Sequence:CCGGTTGCACCATGGCACGAACATCCTCGAGGATGTTCGTGCCATGGTGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267860    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-444s21c1
Sequence:CCGGTACCACCTTCTGCTGTCCTTGCTCGAGCAAGGACAGCAGAAGGTGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-306s21c1
Sequence:CCGGTGTCAGGACAGAGGGTGTTTGCTCGAGCAAACACCCTCTGTCCTGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081108.1-358s21c1
Sequence:CCGGTATTGATGTCTGAGCTATAAACTCGAGTTTATAGCTCAGACATCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)