EMAIL THIS PAGE TO A FRIEND

LAMTOR5

late endosomal/lysosomal adaptor, MAPK and MTOR activator 5

78 Gene Product Result for
Synonyms: HBXIP XIP
UniProtKB ID: O43504, Q6IBD8
Gene ID:
Human(10542) Summary: This gene encodes a protein that specifically complexes with the C-terminus of hepatitis B virus X protein (HBx). The function of this protein is to negatively regulate HBx activity and thus to alter the replication life cycle of the virus. [provided by RefSeq, Jul 2008]
Mouse(68576) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Rat(295357) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
sheep(101111239) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
domestic guinea pig(100721571) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
naked mole-rat(101711437) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Zebrafish(100333504) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
cow(516090) hepatitis B virus x interacting protein
domestic cat(101082839) late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006402 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109361 MISSION® esiRNA esiRNA human HBXIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006402 Rosetta Predictions human pricing
NM_001106462 Rosetta Predictions rat pricing
NM_026774 Rosetta Predictions mouse pricing
XM_909856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341488 predicted 370
2 SASI_Hs01_00143677 predicted 541
3 SASI_Hs01_00143679 predicted 613
4 SASI_Hs01_00143680 predicted 445
5 SASI_Hs01_00143681 predicted 616
6 SASI_Hs01_00143682 predicted 611
7 SASI_Hs01_00143683 predicted 572
8 SASI_Hs01_00143685 predicted 615
9 SASI_Hs02_00341489 predicted 494
10 SASI_Hs01_00143686 predicted 622
11 SASI_Hs01_00143678 predicted 513
12 SASI_Hs01_00143684 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219198 predicted 534
2 SASI_Rn02_00219199 predicted 417
3 SASI_Rn02_00219200 predicted 601
4 SASI_Rn02_00219201 predicted 580
5 SASI_Rn02_00219202 predicted 415
6 SASI_Rn02_00219203 predicted 631
7 SASI_Rn02_00219204 predicted 398
8 SASI_Rn02_00219205 predicted 370
9 SASI_Rn02_00219206 predicted 536
10 SASI_Rn02_00219207 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330839 predicted 408
2 SASI_Mm02_00330840 predicted 494
3 SASI_Mm02_00330841 predicted 480
4 SASI_Mm02_00330842 predicted 485
5 SASI_Mm02_00330843 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_909856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259172 predicted 451
2 SASI_Mm01_00259173 predicted 424
3 SASI_Mm01_00259174 predicted 418
4 SASI_Mm01_00259175 predicted 416
5 SASI_Mm01_00259176 predicted 400
6 SASI_Mm01_00259177 predicted 465
7 SASI_Mm01_00259178 predicted 439
8 SASI_Mm01_00259179 predicted 396
9 SASI_Mm01_00259180 predicted 526
10 SASI_Mm01_00259181 predicted 490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026774
VALIDATED
LAMTOR5 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-240s21c1
Sequence:CCGGGACATCCCTGTGGTATGTTTACTCGAGTAAACATACCACAGGGATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-107s21c1
Sequence:CCGGATCCATTGTTGGAGTCCTATGCTCGAGCATAGGACTCCAACAATGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-129s21c1
Sequence:CCGGACAGATTCACAAGGACTTAATCTCGAGATTAAGTCCTTGTGAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-176s21c1
Sequence:CCGGTGAGCACGCTGGAGTCATATCCTCGAGGATATGACTCCAGCGTGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-420s21c1
Sequence:CCGGGAAATAGGCCATTCAGTTAATCTCGAGATTAACTGAATGGCCTATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026774
VALIDATED
LAMTOR5 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-240s21c1
Sequence:CCGGGACATCCCTGTGGTATGTTTACTCGAGTAAACATACCACAGGGATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-107s21c1
Sequence:CCGGATCCATTGTTGGAGTCCTATGCTCGAGCATAGGACTCCAACAATGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-129s21c1
Sequence:CCGGACAGATTCACAAGGACTTAATCTCGAGATTAAGTCCTTGTGAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-176s21c1
Sequence:CCGGTGAGCACGCTGGAGTCATATCCTCGAGGATATGACTCCAGCGTGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-420s21c1
Sequence:CCGGGAAATAGGCCATTCAGTTAATCTCGAGATTAACTGAATGGCCTATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026774
VALIDATED
LAMTOR5 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-240s21c1
Sequence:CCGGGACATCCCTGTGGTATGTTTACTCGAGTAAACATACCACAGGGATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-107s21c1
Sequence:CCGGATCCATTGTTGGAGTCCTATGCTCGAGCATAGGACTCCAACAATGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-129s21c1
Sequence:CCGGACAGATTCACAAGGACTTAATCTCGAGATTAAGTCCTTGTGAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-176s21c1
Sequence:CCGGTGAGCACGCTGGAGTCATATCCTCGAGGATATGACTCCAGCGTGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026774.1-420s21c1
Sequence:CCGGGAAATAGGCCATTCAGTTAATCTCGAGATTAACTGAATGGCCTATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006402
VALIDATED
LAMTOR5 MISSION shRNA Bacterial Glycerol Stock
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-381s1c1
Sequence:CCGGCACAAGGACTTAATCTGGGTTCTCGAGAACCCAGATTAAGTCCTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-428s1c1
Sequence:CCGGGCTGGAGTGATATCTGTTCTACTCGAGTAGAACAGATATCACTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-529s1c1
Sequence:CCGGGATCCAGAAACACGATGGCATCTCGAGATGCCATCGTGTTTCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-322s1c1
Sequence:CCGGGCAGCACTTGGAAGACACAATCTCGAGATTGTGTCTTCCAAGTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-494s1c1
Sequence:CCGGGTGGTGTGTCTAGAATCAGATCTCGAGATCTGATTCTAGACACACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006402.2-485s1c1
Sequence:CCGGGATATTCCTGTGGTGTGTCTACTCGAGTAGACACACCACAGGAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006402.2-662s1c1
Sequence:CCGGCAGTAGTTAGGCCATTCATTTCTCGAGAAATGAATGGCCTAACTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-372s1c1
Sequence:CCGGGCACAGATTCACAAGGACTTACTCGAGTAAGTCCTTGTGAATCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006402.2-661s1c1
Sequence:CCGGCCAGTAGTTAGGCCATTCATTCTCGAGAATGAATGGCCTAACTACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-325s1c1
Sequence:CCGGGCACTTGGAAGACACAATGAACTCGAGTTCATTGTGTCTTCCAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006402
VALIDATED
LAMTOR5 MISSION shRNA shRNA Plasmid DNA
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-381s1c1
Sequence:CCGGCACAAGGACTTAATCTGGGTTCTCGAGAACCCAGATTAAGTCCTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-428s1c1
Sequence:CCGGGCTGGAGTGATATCTGTTCTACTCGAGTAGAACAGATATCACTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-529s1c1
Sequence:CCGGGATCCAGAAACACGATGGCATCTCGAGATGCCATCGTGTTTCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-322s1c1
Sequence:CCGGGCAGCACTTGGAAGACACAATCTCGAGATTGTGTCTTCCAAGTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-494s1c1
Sequence:CCGGGTGGTGTGTCTAGAATCAGATCTCGAGATCTGATTCTAGACACACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006402.2-485s1c1
Sequence:CCGGGATATTCCTGTGGTGTGTCTACTCGAGTAGACACACCACAGGAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006402.2-662s1c1
Sequence:CCGGCAGTAGTTAGGCCATTCATTTCTCGAGAAATGAATGGCCTAACTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-372s1c1
Sequence:CCGGGCACAGATTCACAAGGACTTACTCGAGTAAGTCCTTGTGAATCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006402.2-661s1c1
Sequence:CCGGCCAGTAGTTAGGCCATTCATTCTCGAGAATGAATGGCCTAACTACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-325s1c1
Sequence:CCGGGCACTTGGAAGACACAATGAACTCGAGTTCATTGTGTCTTCCAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006402
VALIDATED
LAMTOR5 MISSION shRNA Lentiviral Transduction Particles
late endosomal/lysosomal adaptor, MAPK and MTOR activator 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-381s1c1
Sequence:CCGGCACAAGGACTTAATCTGGGTTCTCGAGAACCCAGATTAAGTCCTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-428s1c1
Sequence:CCGGGCTGGAGTGATATCTGTTCTACTCGAGTAGAACAGATATCACTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-529s1c1
Sequence:CCGGGATCCAGAAACACGATGGCATCTCGAGATGCCATCGTGTTTCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-322s1c1
Sequence:CCGGGCAGCACTTGGAAGACACAATCTCGAGATTGTGTCTTCCAAGTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-494s1c1
Sequence:CCGGGTGGTGTGTCTAGAATCAGATCTCGAGATCTGATTCTAGACACACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006402.2-485s1c1
Sequence:CCGGGATATTCCTGTGGTGTGTCTACTCGAGTAGACACACCACAGGAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151965    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006402.2-662s1c1
Sequence:CCGGCAGTAGTTAGGCCATTCATTTCTCGAGAAATGAATGGCCTAACTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-372s1c1
Sequence:CCGGGCACAGATTCACAAGGACTTACTCGAGTAAGTCCTTGTGAATCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006402.2-661s1c1
Sequence:CCGGCCAGTAGTTAGGCCATTCATTCTCGAGAATGAATGGCCTAACTACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006402.2-325s1c1
Sequence:CCGGGCACTTGGAAGACACAATGAACTCGAGTTCATTGTGTCTTCCAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)