EMAIL THIS PAGE TO A FRIEND

LANCL1

LanC lantibiotic synthetase component C-like 1 (bacterial)

157 Gene Product Result for
Synonyms: GPR69A p40
UniProtKB ID: O43813
Gene ID:
Human(10314) Summary: This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2008]
Mouse(14768) LanC (bacterial lantibiotic synthetase component C)-like 1
Rat(114515) LanC lantibiotic synthetase component C-like 1 (bacterial)
Zebrafish(494154) LanC antibiotic synthetase component C-like 1 (bacterial)
dog(478897) LanC lantibiotic synthetase component C-like 1 (bacterial)
Horse(100050050) LanC lantibiotic synthetase component C-like 1 (bacterial)
cow(540559) LanC lantibiotic synthetase component C-like 1 (bacterial)
domestic cat(101099576) LanC lantibiotic synthetase component C-like 1 (bacterial)
chicken(424006) LanC lantibiotic synthetase component C-like 1 (bacterial)
domestic guinea pig(100730755) LanC lantibiotic synthetase component C-like 1 (bacterial)
naked mole-rat(101696874) LanC lantibiotic synthetase component C-like 1 (bacterial)
sheep(101102292) LanC lantibiotic synthetase component C-like 1 (bacterial)
Domestic Rabbit(100344987) LanC lantibiotic synthetase component C-like 1 (bacterial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006055 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006055 siRNAs that have been validated in the lab human pricing
NM_053723 Rosetta Predictions rat pricing
NM_021295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006055 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205994 validated 1136
2 SASI_Hs01_00205995 predicted 962
3 SASI_Hs01_00205996 predicted 863
4 SASI_Hs02_00340810 predicted 876
5 SASI_Hs01_00205997 predicted 863
6 SASI_Hs01_00205998 predicted 1350
7 SASI_Hs01_00205999 predicted 496
8 SASI_Hs01_00206000 predicted 1012
9 SASI_Hs01_00206001 predicted 1155
10 SASI_Hs01_00206002 predicted 1152
11 SASI_Hs01_00206003 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109956 predicted 1003
2 SASI_Rn01_00109957 predicted 548
3 SASI_Rn01_00109958 predicted 551
4 SASI_Rn01_00109959 predicted 882
5 SASI_Rn01_00109960 predicted 685
6 SASI_Rn02_00266489 predicted 614
7 SASI_Rn01_00109961 predicted 922
8 SASI_Rn01_00109962 predicted 1170
9 SASI_Rn01_00109963 predicted 851
10 SASI_Rn01_00109964 predicted 1157
11 SASI_Rn01_00109965 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064331 predicted 876
2 SASI_Mm01_00064332 predicted 805
3 SASI_Mm02_00325832 predicted 1396
4 SASI_Mm02_00325833 predicted 964
5 SASI_Mm01_00064333 predicted 1346
6 SASI_Mm01_00064334 predicted 842
7 SASI_Mm01_00064335 predicted 1240
8 SASI_Mm01_00064338 predicted 538
9 SASI_Mm01_00064339 predicted 1280
10 SASI_Mm01_00064336 predicted 1384
11 SASI_Mm01_00064337 predicted 1402
12 SASI_Mm01_00064340 predicted 869
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021295
LANCL1 MISSION shRNA Bacterial Glycerol Stock
LanC lantibiotic synthetase component C-like 1 (bacterial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-544s1c1
Sequence:CCGGCGTACCAAATGAAATGCTCTACTCGAGTAGAGCATTTCATTTGGTACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-814s1c1
Sequence:CCGGCCAAGGAAAGTTGCATAGTTTCTCGAGAAACTATGCAACTTTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-369s1c1
Sequence:CCGGCGCACAGCTATGTAAAGCAAACTCGAGTTTGCTTTACATAGCTGTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021295.1-3111s1c1
Sequence:CCGGGCCCACTTTGTTTAGTTAAATCTCGAGATTTAACTAAACAAAGTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-971s1c1
Sequence:CCGGGCATACAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTGTATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-369s21c1
Sequence:CCGGCGCACAGCTATGTAAAGCAAACTCGAGTTTGCTTTACATAGCTGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-971s21c1
Sequence:CCGGGCATACAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-544s21c1
Sequence:CCGGCGTACCAAATGAAATGCTCTACTCGAGTAGAGCATTTCATTTGGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-814s21c1
Sequence:CCGGCCAAGGAAAGTTGCATAGTTTCTCGAGAAACTATGCAACTTTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021295
LANCL1 MISSION shRNA shRNA Plasmid DNA
LanC lantibiotic synthetase component C-like 1 (bacterial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-544s1c1
Sequence:CCGGCGTACCAAATGAAATGCTCTACTCGAGTAGAGCATTTCATTTGGTACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-814s1c1
Sequence:CCGGCCAAGGAAAGTTGCATAGTTTCTCGAGAAACTATGCAACTTTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-369s1c1
Sequence:CCGGCGCACAGCTATGTAAAGCAAACTCGAGTTTGCTTTACATAGCTGTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021295.1-3111s1c1
Sequence:CCGGGCCCACTTTGTTTAGTTAAATCTCGAGATTTAACTAAACAAAGTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-971s1c1
Sequence:CCGGGCATACAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTGTATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-369s21c1
Sequence:CCGGCGCACAGCTATGTAAAGCAAACTCGAGTTTGCTTTACATAGCTGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-971s21c1
Sequence:CCGGGCATACAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-544s21c1
Sequence:CCGGCGTACCAAATGAAATGCTCTACTCGAGTAGAGCATTTCATTTGGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-814s21c1
Sequence:CCGGCCAAGGAAAGTTGCATAGTTTCTCGAGAAACTATGCAACTTTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021295
LANCL1 MISSION shRNA Lentiviral Transduction Particles
LanC lantibiotic synthetase component C-like 1 (bacterial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-544s1c1
Sequence:CCGGCGTACCAAATGAAATGCTCTACTCGAGTAGAGCATTTCATTTGGTACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-814s1c1
Sequence:CCGGCCAAGGAAAGTTGCATAGTTTCTCGAGAAACTATGCAACTTTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-369s1c1
Sequence:CCGGCGCACAGCTATGTAAAGCAAACTCGAGTTTGCTTTACATAGCTGTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028905    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021295.1-3111s1c1
Sequence:CCGGGCCCACTTTGTTTAGTTAAATCTCGAGATTTAACTAAACAAAGTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021295.1-971s1c1
Sequence:CCGGGCATACAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTGTATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-369s21c1
Sequence:CCGGCGCACAGCTATGTAAAGCAAACTCGAGTTTGCTTTACATAGCTGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-971s21c1
Sequence:CCGGGCATACAAGGTGTTCAAAGAACTCGAGTTCTTTGAACACCTTGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-544s21c1
Sequence:CCGGCGTACCAAATGAAATGCTCTACTCGAGTAGAGCATTTCATTTGGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021295.2-814s21c1
Sequence:CCGGCCAAGGAAAGTTGCATAGTTTCTCGAGAAACTATGCAACTTTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006055
VALIDATED
LANCL1 MISSION shRNA Bacterial Glycerol Stock
LanC lantibiotic synthetase component C-like 1 (bacterial)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-508s1c1
Sequence:CCGGCACGGCTAATTCACCTAAATACTCGAGTATTTAGGTGAATTAGCCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-309s1c1
Sequence:CCGGGCTGTGCTTTACTTACATCTTCTCGAGAAGATGTAAGTAAAGCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-1133s1c1
Sequence:CCGGGTACCTGTATAGGGCCTGTAACTCGAGTTACAGGCCCTATACAGGTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-543s1c1
Sequence:CCGGGCTCCAAATGAAATGCTCTATCTCGAGATAGAGCATTTCATTTGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-1384s1c1
Sequence:CCGGCCAAGGAAACAAAGAGTCAAACTCGAGTTTGACTCTTTGTTTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006055.2-603s21c1
Sequence:CCGGGCTCCAAATGAAATGCTCTATCTCGAGATAGAGCATTTCATTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006055.2-369s21c1
Sequence:CCGGGCTGTGCTTTACTTACATCTTCTCGAGAAGATGTAAGTAAAGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-1444s21c1
Sequence:CCGGCCAAGGAAACAAAGAGTCAAACTCGAGTTTGACTCTTTGTTTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-1017s21c1
Sequence:CCGGATGCTCATCCAGGCCTATAAGCTCGAGCTTATAGGCCTGGATGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-558s21c1
Sequence:CCGGGATTGCATCACACGGCTAATTCTCGAGAATTAGCCGTGTGATGCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006055
VALIDATED
LANCL1 MISSION shRNA shRNA Plasmid DNA
LanC lantibiotic synthetase component C-like 1 (bacterial)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-508s1c1
Sequence:CCGGCACGGCTAATTCACCTAAATACTCGAGTATTTAGGTGAATTAGCCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-309s1c1
Sequence:CCGGGCTGTGCTTTACTTACATCTTCTCGAGAAGATGTAAGTAAAGCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-1133s1c1
Sequence:CCGGGTACCTGTATAGGGCCTGTAACTCGAGTTACAGGCCCTATACAGGTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-543s1c1
Sequence:CCGGGCTCCAAATGAAATGCTCTATCTCGAGATAGAGCATTTCATTTGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-1384s1c1
Sequence:CCGGCCAAGGAAACAAAGAGTCAAACTCGAGTTTGACTCTTTGTTTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006055.2-603s21c1
Sequence:CCGGGCTCCAAATGAAATGCTCTATCTCGAGATAGAGCATTTCATTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006055.2-369s21c1
Sequence:CCGGGCTGTGCTTTACTTACATCTTCTCGAGAAGATGTAAGTAAAGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-1444s21c1
Sequence:CCGGCCAAGGAAACAAAGAGTCAAACTCGAGTTTGACTCTTTGTTTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-1017s21c1
Sequence:CCGGATGCTCATCCAGGCCTATAAGCTCGAGCTTATAGGCCTGGATGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-558s21c1
Sequence:CCGGGATTGCATCACACGGCTAATTCTCGAGAATTAGCCGTGTGATGCAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006055
VALIDATED
LANCL1 MISSION shRNA Lentiviral Transduction Particles
LanC lantibiotic synthetase component C-like 1 (bacterial)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-508s1c1
Sequence:CCGGCACGGCTAATTCACCTAAATACTCGAGTATTTAGGTGAATTAGCCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-309s1c1
Sequence:CCGGGCTGTGCTTTACTTACATCTTCTCGAGAAGATGTAAGTAAAGCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-1133s1c1
Sequence:CCGGGTACCTGTATAGGGCCTGTAACTCGAGTTACAGGCCCTATACAGGTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-543s1c1
Sequence:CCGGGCTCCAAATGAAATGCTCTATCTCGAGATAGAGCATTTCATTTGGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006055.1-1384s1c1
Sequence:CCGGCCAAGGAAACAAAGAGTCAAACTCGAGTTTGACTCTTTGTTTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006055.2-603s21c1
Sequence:CCGGGCTCCAAATGAAATGCTCTATCTCGAGATAGAGCATTTCATTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006055.2-369s21c1
Sequence:CCGGGCTGTGCTTTACTTACATCTTCTCGAGAAGATGTAAGTAAAGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-1444s21c1
Sequence:CCGGCCAAGGAAACAAAGAGTCAAACTCGAGTTTGACTCTTTGTTTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-1017s21c1
Sequence:CCGGATGCTCATCCAGGCCTATAAGCTCGAGCTTATAGGCCTGGATGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006055.2-558s21c1
Sequence:CCGGGATTGCATCACACGGCTAATTCTCGAGAATTAGCCGTGTGATGCAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)