EMAIL THIS PAGE TO A FRIEND

LANCL3

LanC lantibiotic synthetase component C-like 3 (bacterial)

47 Gene Product Result for
UniProtKB ID: Q6ZV70, A6NHE3
Gene ID:
Mouse(236285) LanC lantibiotic synthetase component C-like 3 (bacterial)
Rat(302540) LanC lantibiotic synthetase component C-like 3 (bacterial)
chicken(427992) LanC lantibiotic synthetase component C-like 3 (bacterial)
dog(491823) LanC lantibiotic synthetase component C-like 3 (bacterial)
cow(519239) LanC lantibiotic synthetase component C-like 3 (bacterial)
domestic cat(101082726) LanC lantibiotic synthetase component C-like 3 (bacterial)
domestic guinea pig(100721328) LanC lantibiotic synthetase component C-like 3 (bacterial)
naked mole-rat(101710207) LanC lantibiotic synthetase component C-like 3 (bacterial)
sheep(101120057) LanC lantibiotic synthetase component C-like 3 (bacterial)
Domestic Rabbit(100339847) LanC lantibiotic synthetase component C-like 3 (bacterial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198511 Rosetta Predictions human pricing
XM_228739 Rosetta Predictions rat pricing
NM_173414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227279 predicted 1061
2 SASI_Hs01_00227280 predicted 1009
3 SASI_Hs01_00227281 predicted 887
4 SASI_Hs01_00227282 predicted 516
5 SASI_Hs01_00227283 predicted 1397
6 SASI_Hs01_00227284 predicted 1468
7 SASI_Hs01_00227285 predicted 1213
8 SASI_Hs02_00372081 predicted 967
9 SASI_Hs01_00227287 predicted 966
10 SASI_Hs01_00227288 predicted 1541
11 SASI_Hs01_00227286 predicted 1030
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385427 predicted 1268
2 SASI_Rn02_00385428 predicted 1172
3 SASI_Rn02_00385429 predicted 1351
4 SASI_Rn02_00385430 predicted 423
5 SASI_Rn02_00385431 predicted 701
6 SASI_Rn02_00385432 predicted 1261
7 SASI_Rn02_00385433 predicted 1028
8 SASI_Rn02_00385434 predicted 1115
9 SASI_Rn02_00385435 predicted 933
10 SASI_Rn02_00385436 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045043 predicted 1313
2 SASI_Mm02_00345281 predicted 1443
3 SASI_Mm01_00045044 predicted 1287
4 SASI_Mm01_00045045 predicted 1414
5 SASI_Mm01_00045047 predicted 1356
6 SASI_Mm01_00045048 predicted 918
7 SASI_Mm01_00045049 predicted 1349
8 SASI_Mm01_00045050 predicted 1109
9 SASI_Mm01_00045051 predicted 1332
10 SASI_Mm01_00045052 predicted 1586
11 SASI_Mm01_00045046 predicted 477
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198511
LANCL3 MISSION shRNA Bacterial Glycerol Stock
LanC lantibiotic synthetase component C-like 3 (bacterial)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000128402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-929s1c1
Sequence:CCGGGAAGCAGTATGCCATAAAGAACTCGAGTTCTTTATGGCATACTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-1744s1c1
Sequence:CCGGGCCTTAACATTGCCATCAGAACTCGAGTTCTGATGGCAATGTTAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-1733s1c1
Sequence:CCGGCGCAACCATGAGCCTTAACATCTCGAGATGTTAAGGCTCATGGTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1091s1c1
Sequence:CCGGCGTGGACTTTCTCATGGAACACTCGAGTGTTCCATGAGAAAGTCCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1217s1c1
Sequence:CCGGCAAAGCTTATCTGGTTTCCAACTCGAGTTGGAAACCAGATAAGCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1398s1c1
Sequence:CCGGGCTCAAAGTTCATTCCCTGTACTCGAGTACAGGGAATGAACTTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1095s1c1
Sequence:CCGGGACTTTCTCATGGAACAGGAACTCGAGTTCCTGTTCCATGAGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-2708s1c1
Sequence:CCGGCCACTAGAAATTGGCTGTAATCTCGAGATTACAGCCAATTTCTAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1370s1c1
Sequence:CCGGCACGGGAAACTCTAAATACATCTCGAGATGTATTTAGAGTTTCCCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-896s1c1
Sequence:CCGGCAAGTCAATTTGTCAGGCAATCTCGAGATTGCCTGACAAATTGACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1372s1c1
Sequence:CCGGCGGGAAACTCTAAATACATCTCTCGAGAGATGTATTTAGAGTTTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198511
LANCL3 MISSION shRNA shRNA Plasmid DNA
LanC lantibiotic synthetase component C-like 3 (bacterial)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000128402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-929s1c1
Sequence:CCGGGAAGCAGTATGCCATAAAGAACTCGAGTTCTTTATGGCATACTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-1744s1c1
Sequence:CCGGGCCTTAACATTGCCATCAGAACTCGAGTTCTGATGGCAATGTTAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-1733s1c1
Sequence:CCGGCGCAACCATGAGCCTTAACATCTCGAGATGTTAAGGCTCATGGTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1091s1c1
Sequence:CCGGCGTGGACTTTCTCATGGAACACTCGAGTGTTCCATGAGAAAGTCCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1217s1c1
Sequence:CCGGCAAAGCTTATCTGGTTTCCAACTCGAGTTGGAAACCAGATAAGCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1398s1c1
Sequence:CCGGGCTCAAAGTTCATTCCCTGTACTCGAGTACAGGGAATGAACTTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1095s1c1
Sequence:CCGGGACTTTCTCATGGAACAGGAACTCGAGTTCCTGTTCCATGAGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-2708s1c1
Sequence:CCGGCCACTAGAAATTGGCTGTAATCTCGAGATTACAGCCAATTTCTAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1370s1c1
Sequence:CCGGCACGGGAAACTCTAAATACATCTCGAGATGTATTTAGAGTTTCCCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-896s1c1
Sequence:CCGGCAAGTCAATTTGTCAGGCAATCTCGAGATTGCCTGACAAATTGACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1372s1c1
Sequence:CCGGCGGGAAACTCTAAATACATCTCTCGAGAGATGTATTTAGAGTTTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198511
LANCL3 MISSION shRNA Lentiviral Transduction Particles
LanC lantibiotic synthetase component C-like 3 (bacterial)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000128402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-929s1c1
Sequence:CCGGGAAGCAGTATGCCATAAAGAACTCGAGTTCTTTATGGCATACTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149937    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-1744s1c1
Sequence:CCGGGCCTTAACATTGCCATCAGAACTCGAGTTCTGATGGCAATGTTAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-1733s1c1
Sequence:CCGGCGCAACCATGAGCCTTAACATCTCGAGATGTTAAGGCTCATGGTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1091s1c1
Sequence:CCGGCGTGGACTTTCTCATGGAACACTCGAGTGTTCCATGAGAAAGTCCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1217s1c1
Sequence:CCGGCAAAGCTTATCTGGTTTCCAACTCGAGTTGGAAACCAGATAAGCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1398s1c1
Sequence:CCGGGCTCAAAGTTCATTCCCTGTACTCGAGTACAGGGAATGAACTTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1095s1c1
Sequence:CCGGGACTTTCTCATGGAACAGGAACTCGAGTTCCTGTTCCATGAGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198511.1-2708s1c1
Sequence:CCGGCCACTAGAAATTGGCTGTAATCTCGAGATTACAGCCAATTTCTAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1370s1c1
Sequence:CCGGCACGGGAAACTCTAAATACATCTCGAGATGTATTTAGAGTTTCCCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-896s1c1
Sequence:CCGGCAAGTCAATTTGTCAGGCAATCTCGAGATTGCCTGACAAATTGACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198511.1-1372s1c1
Sequence:CCGGCGGGAAACTCTAAATACATCTCTCGAGAGATGTATTTAGAGTTTCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173414
LANCL3 MISSION shRNA Bacterial Glycerol Stock
LanC lantibiotic synthetase component C-like 3 (bacterial)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1366s1c1
Sequence:CCGGGCTCAGTTCTTATTCACTGAACTCGAGTTCAGTGAATAAGAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1453s1c1
Sequence:CCGGGTTTGCTTTCTCATTGATCTACTCGAGTAGATCAATGAGAAAGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1355s1c1
Sequence:CCGGCCCAAAGGTTTGCTCAGTTCTCTCGAGAGAACTGAGCAAACCTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-840s1c1
Sequence:CCGGCCCAACACAAATTAAAGCAATCTCGAGATTGCTTTAATTTGTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173414.1-2664s1c1
Sequence:CCGGGCTCCATTTCATCCTATTATACTCGAGTATAATAGGATGAAATGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173414
LANCL3 MISSION shRNA shRNA Plasmid DNA
LanC lantibiotic synthetase component C-like 3 (bacterial)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1366s1c1
Sequence:CCGGGCTCAGTTCTTATTCACTGAACTCGAGTTCAGTGAATAAGAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1453s1c1
Sequence:CCGGGTTTGCTTTCTCATTGATCTACTCGAGTAGATCAATGAGAAAGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1355s1c1
Sequence:CCGGCCCAAAGGTTTGCTCAGTTCTCTCGAGAGAACTGAGCAAACCTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-840s1c1
Sequence:CCGGCCCAACACAAATTAAAGCAATCTCGAGATTGCTTTAATTTGTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173414.1-2664s1c1
Sequence:CCGGGCTCCATTTCATCCTATTATACTCGAGTATAATAGGATGAAATGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173414
LANCL3 MISSION shRNA Lentiviral Transduction Particles
LanC lantibiotic synthetase component C-like 3 (bacterial)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1366s1c1
Sequence:CCGGGCTCAGTTCTTATTCACTGAACTCGAGTTCAGTGAATAAGAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1453s1c1
Sequence:CCGGGTTTGCTTTCTCATTGATCTACTCGAGTAGATCAATGAGAAAGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-1355s1c1
Sequence:CCGGCCCAAAGGTTTGCTCAGTTCTCTCGAGAGAACTGAGCAAACCTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173414.1-840s1c1
Sequence:CCGGCCCAACACAAATTAAAGCAATCTCGAGATTGCTTTAATTTGTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126844    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173414.1-2664s1c1
Sequence:CCGGGCTCCATTTCATCCTATTATACTCGAGTATAATAGGATGAAATGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)