EMAIL THIS PAGE TO A FRIEND

LAP3

leucine aminopeptidase 3

84 Gene Product Result for
Synonyms: LAP LAPEP PEPS
UniProtKB ID: P28838, B3KMQ3, Q6IAM6, Q6P0L6, Q9UQE3
Gene ID:
Mouse(66988) leucine aminopeptidase 3
Rat(289668) leucine aminopeptidase 3
sheep(101120750) leucine aminopeptidase 3
Domestic Rabbit(100346688) leucine aminopeptidase 3
domestic guinea pig(100717343) leucine aminopeptidase 3
naked mole-rat(101712957) leucine aminopeptidase 3
Zebrafish(562854) leucine aminopeptidase 3
chicken(425306) leucine aminopeptidase 3
dog(479081) leucine aminopeptidase 3
Thale Cress(825122) pollen development protein LAP3
domestic cat(101086559) leucine aminopeptidase 3
cow(781648) leucine aminopeptidase 3
Horse(100068668) leucine aminopeptidase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
A6671 Actinonin human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015907 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015907 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015907 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024434 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024434 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024434 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108251 MISSION® esiRNA esiRNA human LAP3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015907 Rosetta Predictions human pricing
NM_001011910 Rosetta Predictions rat pricing
XM_573621 Rosetta Predictions rat pricing
NM_024434 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124487 predicted 1117
2 SASI_Hs01_00124488 predicted 1616
3 SASI_Hs01_00124489 predicted 1298
4 SASI_Hs01_00124490 predicted 1459
5 SASI_Hs01_00124491 predicted 1578
6 SASI_Hs02_00348504 predicted 1583
7 SASI_Hs02_00348505 predicted 1553
8 SASI_Hs01_00124494 predicted 1314
9 SASI_Hs01_00124495 predicted 1331
10 SASI_Hs01_00124496 predicted 1088
11 SASI_Hs01_00124492 predicted 1510
12 SASI_Hs01_00124493 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107267 predicted 1458
2 SASI_Rn01_00107268 predicted 909
3 SASI_Rn01_00107269 predicted 669
4 SASI_Rn01_00107270 predicted 868
5 SASI_Rn01_00107271 predicted 1191
6 SASI_Rn01_00107273 predicted 1621
7 SASI_Rn01_00107274 predicted 1443
8 SASI_Rn01_00107275 predicted 996
9 SASI_Rn01_00107276 predicted 1510
10 SASI_Rn02_00199902 predicted 1548
11 SASI_Rn01_00107272 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189330 predicted 1463
2 SASI_Rn01_00189331 predicted 921
3 SASI_Rn01_00189332 predicted 678
4 SASI_Rn01_00189333 predicted 874
5 SASI_Rn01_00189334 predicted 1204
6 SASI_Rn01_00189335 predicted 664
7 SASI_Rn01_00189336 predicted 1624
8 SASI_Rn01_00189337 predicted 1452
9 SASI_Rn01_00189338 predicted 1003
10 SASI_Rn01_00189339 predicted 1513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024434 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169312 predicted 1331
2 SASI_Mm01_00169313 predicted 955
3 SASI_Mm02_00327754 predicted 761
4 SASI_Mm01_00169314 predicted 909
5 SASI_Mm01_00169315 predicted 1007
6 SASI_Mm01_00169316 predicted 1200
7 SASI_Mm01_00169319 predicted 1358
8 SASI_Mm01_00169320 predicted 996
9 SASI_Mm01_00169321 predicted 618
10 SASI_Mm02_00327755 predicted 1371
11 SASI_Mm01_00169317 predicted 1461
12 SASI_Mm01_00169318 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015907
VALIDATED
LAP3 MISSION shRNA Bacterial Glycerol Stock
leucine aminopeptidase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-1581s1c1
Sequence:CCGGTCATCCTAAGTGGGCACATTTCTCGAGAAATGTGCCCACTTAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_015907.2-478s1c1
Sequence:CCGGGCTGGAATCGACGAACAGGAACTCGAGTTCCTGTTCGTCGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-794s1c1
Sequence:CCGGCGCCAACCAGATTTGCTGAAACTCGAGTTTCAGCAAATCTGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_015907.2-1120s1c1
Sequence:CCGGGCAAAGCTTAATTTGCCCATTCTCGAGAATGGGCAAATTAAGCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-868s1c1
Sequence:CCGGCCCAAGTCTTGGATTGAGGAACTCGAGTTCCTCAATCCAAGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-794s21c1
Sequence:CCGGCGCCAACCAGATTTGCTGAAACTCGAGTTTCAGCAAATCTGGTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-1581s21c1
Sequence:CCGGTCATCCTAAGTGGGCACATTTCTCGAGAAATGTGCCCACTTAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015907.2-478s21c1
Sequence:CCGGGCTGGAATCGACGAACAGGAACTCGAGTTCCTGTTCGTCGATTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-868s21c1
Sequence:CCGGCCCAAGTCTTGGATTGAGGAACTCGAGTTCCTCAATCCAAGACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015907
VALIDATED
LAP3 MISSION shRNA shRNA Plasmid DNA
leucine aminopeptidase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-1581s1c1
Sequence:CCGGTCATCCTAAGTGGGCACATTTCTCGAGAAATGTGCCCACTTAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_015907.2-478s1c1
Sequence:CCGGGCTGGAATCGACGAACAGGAACTCGAGTTCCTGTTCGTCGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-794s1c1
Sequence:CCGGCGCCAACCAGATTTGCTGAAACTCGAGTTTCAGCAAATCTGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_015907.2-1120s1c1
Sequence:CCGGGCAAAGCTTAATTTGCCCATTCTCGAGAATGGGCAAATTAAGCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-868s1c1
Sequence:CCGGCCCAAGTCTTGGATTGAGGAACTCGAGTTCCTCAATCCAAGACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-794s21c1
Sequence:CCGGCGCCAACCAGATTTGCTGAAACTCGAGTTTCAGCAAATCTGGTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-1581s21c1
Sequence:CCGGTCATCCTAAGTGGGCACATTTCTCGAGAAATGTGCCCACTTAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015907.2-478s21c1
Sequence:CCGGGCTGGAATCGACGAACAGGAACTCGAGTTCCTGTTCGTCGATTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-868s21c1
Sequence:CCGGCCCAAGTCTTGGATTGAGGAACTCGAGTTCCTCAATCCAAGACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015907
VALIDATED
LAP3 MISSION shRNA Lentiviral Transduction Particles
leucine aminopeptidase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-1581s1c1
Sequence:CCGGTCATCCTAAGTGGGCACATTTCTCGAGAAATGTGCCCACTTAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_015907.2-478s1c1
Sequence:CCGGGCTGGAATCGACGAACAGGAACTCGAGTTCCTGTTCGTCGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-794s1c1
Sequence:CCGGCGCCAACCAGATTTGCTGAAACTCGAGTTTCAGCAAATCTGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_015907.2-1120s1c1
Sequence:CCGGGCAAAGCTTAATTTGCCCATTCTCGAGAATGGGCAAATTAAGCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015907.2-868s1c1
Sequence:CCGGCCCAAGTCTTGGATTGAGGAACTCGAGTTCCTCAATCCAAGACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-794s21c1
Sequence:CCGGCGCCAACCAGATTTGCTGAAACTCGAGTTTCAGCAAATCTGGTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-1581s21c1
Sequence:CCGGTCATCCTAAGTGGGCACATTTCTCGAGAAATGTGCCCACTTAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015907.2-478s21c1
Sequence:CCGGGCTGGAATCGACGAACAGGAACTCGAGTTCCTGTTCGTCGATTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015907.2-868s21c1
Sequence:CCGGCCCAAGTCTTGGATTGAGGAACTCGAGTTCCTCAATCCAAGACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024434
VALIDATED
LAP3 MISSION shRNA Bacterial Glycerol Stock
leucine aminopeptidase 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-749s21c1
Sequence:CCGGCCTGGATAGAGGAACAAGAAACTCGAGTTTCTTGTTCCTCTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-1011s1c1
Sequence:CCGGGCCCATTAACATCATTGGTTTCTCGAGAAACCAATGATGTTAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-967s1c1
Sequence:CCGGGCAACAATATGCTCGGCCATTCTCGAGAATGGCCGAGCATATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-752s1c1
Sequence:CCGGCCTGGATAGAGGAACAAGAAACTCGAGTTTCTTGTTCCTCTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-237s1c1
Sequence:CCGGGCTGAGGGAAATGTTGAACATCTCGAGATGTTCAACATTTCCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024434.3-1486s1c1
Sequence:CCGGGCAGGAGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-964s21c3
Sequence:CCGGGCAACAATATGCTCGGCCATTCTCGAGAATGGCCGAGCATATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-1008s21c2
Sequence:CCGGGCCCATTAACATCATTGGTTTCTCGAGAAACCAATGATGTTAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-1483s21c1
Sequence:CCGGGCAGGAGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-234s21c1
Sequence:CCGGGCTGAGGGAAATGTTGAACATCTCGAGATGTTCAACATTTCCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024434
VALIDATED
LAP3 MISSION shRNA shRNA Plasmid DNA
leucine aminopeptidase 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-749s21c1
Sequence:CCGGCCTGGATAGAGGAACAAGAAACTCGAGTTTCTTGTTCCTCTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-1011s1c1
Sequence:CCGGGCCCATTAACATCATTGGTTTCTCGAGAAACCAATGATGTTAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-967s1c1
Sequence:CCGGGCAACAATATGCTCGGCCATTCTCGAGAATGGCCGAGCATATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-752s1c1
Sequence:CCGGCCTGGATAGAGGAACAAGAAACTCGAGTTTCTTGTTCCTCTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-237s1c1
Sequence:CCGGGCTGAGGGAAATGTTGAACATCTCGAGATGTTCAACATTTCCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024434.3-1486s1c1
Sequence:CCGGGCAGGAGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-964s21c3
Sequence:CCGGGCAACAATATGCTCGGCCATTCTCGAGAATGGCCGAGCATATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-1008s21c2
Sequence:CCGGGCCCATTAACATCATTGGTTTCTCGAGAAACCAATGATGTTAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-1483s21c1
Sequence:CCGGGCAGGAGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-234s21c1
Sequence:CCGGGCTGAGGGAAATGTTGAACATCTCGAGATGTTCAACATTTCCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024434
VALIDATED
LAP3 MISSION shRNA Lentiviral Transduction Particles
leucine aminopeptidase 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-749s21c1
Sequence:CCGGCCTGGATAGAGGAACAAGAAACTCGAGTTTCTTGTTCCTCTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-1011s1c1
Sequence:CCGGGCCCATTAACATCATTGGTTTCTCGAGAAACCAATGATGTTAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-967s1c1
Sequence:CCGGGCAACAATATGCTCGGCCATTCTCGAGAATGGCCGAGCATATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-752s1c1
Sequence:CCGGCCTGGATAGAGGAACAAGAAACTCGAGTTTCTTGTTCCTCTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024434.3-237s1c1
Sequence:CCGGGCTGAGGGAAATGTTGAACATCTCGAGATGTTCAACATTTCCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024434.3-1486s1c1
Sequence:CCGGGCAGGAGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-964s21c3
Sequence:CCGGGCAACAATATGCTCGGCCATTCTCGAGAATGGCCGAGCATATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-1008s21c2
Sequence:CCGGGCCCATTAACATCATTGGTTTCTCGAGAAACCAATGATGTTAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-1483s21c1
Sequence:CCGGGCAGGAGTGATGACCAACAAACTCGAGTTTGTTGGTCATCACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024434.5-234s21c1
Sequence:CCGGGCTGAGGGAAATGTTGAACATCTCGAGATGTTCAACATTTCCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)