EMAIL THIS PAGE TO A FRIEND

LAPTM4A

lysosomal protein transmembrane 4 alpha

94 Gene Product Result for
Synonyms: HUMORF13 LAPTM4 MBNT Mtrp
UniProtKB ID: Q15012, Q6UW22
Gene ID:
Human(9741) Summary: This gene encodes a protein that has four predicted transmembrane domains. The function of this gene has not yet been determined; however, studies in the mouse homolog suggest a role in the transport of small molecules across endosomal and lysosomal membranes. [provided by RefSeq, Jul 2008]
Mouse(17775) lysosomal-associated protein transmembrane 4A
Rat(298875) lysosomal protein transmembrane 4 alpha
Zebrafish(100003844) lysosomal-associated protein transmembrane 4 alpha
cow(404135) lysosomal protein transmembrane 4 alpha
domestic cat(101100203) lysosomal protein transmembrane 4 alpha
dog(475678) lysosomal protein transmembrane 4 alpha
chicken(421959) lysosomal protein transmembrane 4 alpha
domestic guinea pig(100724309) lysosomal protein transmembrane 4 alpha
naked mole-rat(101723178) lysosomal protein transmembrane 4 alpha
sheep(101103549) lysosomal protein transmembrane 4 alpha
Domestic Rabbit(100009331) lysosomal protein transmembrane 4 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014713 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014713 Rosetta Predictions human pricing
NM_199384 Rosetta Predictions rat pricing
NM_008640 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135392 predicted 802
2 SASI_Hs01_00135393 predicted 558
3 SASI_Hs01_00135394 predicted 696
4 SASI_Hs01_00135395 predicted 799
5 SASI_Hs01_00135396 predicted 538
6 SASI_Hs01_00135389 predicted 540
7 SASI_Hs01_00135390 predicted 349
8 SASI_Hs01_00135391 predicted 277
9 SASI_Hs01_00135397 predicted 393
10 SASI_Hs01_00135398 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062705 predicted 305
2 SASI_Rn01_00062706 predicted 671
3 SASI_Rn01_00062707 predicted 805
4 SASI_Rn01_00062708 predicted 782
5 SASI_Rn01_00062709 predicted 269
6 SASI_Rn01_00062710 predicted 370
7 SASI_Rn02_00270198 predicted 717
8 SASI_Rn01_00062711 predicted 249
9 SASI_Rn01_00062712 predicted 260
10 SASI_Rn02_00270199 predicted 277
11 SASI_Rn01_00062713 predicted 613
12 SASI_Rn01_00062714 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090011 predicted 1097
2 SASI_Mm01_00090013 predicted 1159
3 SASI_Mm02_00314363 predicted 1593
4 SASI_Mm01_00090014 predicted 1515
5 SASI_Mm01_00090015 predicted 1415
6 SASI_Mm01_00090016 predicted 1214
7 SASI_Mm01_00090017 predicted 1409
8 SASI_Mm01_00090018 predicted 1105
9 SASI_Mm01_00090019 predicted 1163
10 SASI_Mm01_00090020 predicted 1164
11 SASI_Mm01_00090012 predicted 1395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008640
LAPTM4A MISSION shRNA Bacterial Glycerol Stock
lysosomal protein transmembrane 4 alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1406s21c1
Sequence:CCGGGCTTACCTAATCAATTGTGTTCTCGAGAACACAATTGATTAGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1052s21c1
Sequence:CCGGGCTGTCAACATTCAGTATGAACTCGAGTTCATACTGAATGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1063s21c1
Sequence:CCGGTCAGTATGAAGTCATTGGTAACTCGAGTTACCAATGACTTCATACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1306s21c1
Sequence:CCGGGTTGCCTGATTTCCCATACAACTCGAGTTGTATGGGAAATCAGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008640.2-1589s21c1
Sequence:CCGGGCCTTGTCAATAAAGCCTATACTCGAGTATAGGCTTTATTGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-919s1c1
Sequence:CCGGGCTGTCAACATTCAGTATGAACTCGAGTTCATACTGAATGTTGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-1273s1c1
Sequence:CCGGGCTTACCTAATCAATTGTGTTCTCGAGAACACAATTGATTAGGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-930s1c1
Sequence:CCGGTCAGTATGAAGTCATTGGTAACTCGAGTTACCAATGACTTCATACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008640.1-1456s1c1
Sequence:CCGGGCCTTGTCAATAAAGCCTATACTCGAGTATAGGCTTTATTGACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-1173s1c1
Sequence:CCGGGTTGCCTGATTTCCCATACAACTCGAGTTGTATGGGAAATCAGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008640
LAPTM4A MISSION shRNA shRNA Plasmid DNA
lysosomal protein transmembrane 4 alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1406s21c1
Sequence:CCGGGCTTACCTAATCAATTGTGTTCTCGAGAACACAATTGATTAGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1052s21c1
Sequence:CCGGGCTGTCAACATTCAGTATGAACTCGAGTTCATACTGAATGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1063s21c1
Sequence:CCGGTCAGTATGAAGTCATTGGTAACTCGAGTTACCAATGACTTCATACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1306s21c1
Sequence:CCGGGTTGCCTGATTTCCCATACAACTCGAGTTGTATGGGAAATCAGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008640.2-1589s21c1
Sequence:CCGGGCCTTGTCAATAAAGCCTATACTCGAGTATAGGCTTTATTGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-919s1c1
Sequence:CCGGGCTGTCAACATTCAGTATGAACTCGAGTTCATACTGAATGTTGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-1273s1c1
Sequence:CCGGGCTTACCTAATCAATTGTGTTCTCGAGAACACAATTGATTAGGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-930s1c1
Sequence:CCGGTCAGTATGAAGTCATTGGTAACTCGAGTTACCAATGACTTCATACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008640.1-1456s1c1
Sequence:CCGGGCCTTGTCAATAAAGCCTATACTCGAGTATAGGCTTTATTGACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-1173s1c1
Sequence:CCGGGTTGCCTGATTTCCCATACAACTCGAGTTGTATGGGAAATCAGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008640
LAPTM4A MISSION shRNA Lentiviral Transduction Particles
lysosomal protein transmembrane 4 alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1406s21c1
Sequence:CCGGGCTTACCTAATCAATTGTGTTCTCGAGAACACAATTGATTAGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1052s21c1
Sequence:CCGGGCTGTCAACATTCAGTATGAACTCGAGTTCATACTGAATGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1063s21c1
Sequence:CCGGTCAGTATGAAGTCATTGGTAACTCGAGTTACCAATGACTTCATACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008640.2-1306s21c1
Sequence:CCGGGTTGCCTGATTTCCCATACAACTCGAGTTGTATGGGAAATCAGGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008640.2-1589s21c1
Sequence:CCGGGCCTTGTCAATAAAGCCTATACTCGAGTATAGGCTTTATTGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-919s1c1
Sequence:CCGGGCTGTCAACATTCAGTATGAACTCGAGTTCATACTGAATGTTGACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-1273s1c1
Sequence:CCGGGCTTACCTAATCAATTGTGTTCTCGAGAACACAATTGATTAGGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-930s1c1
Sequence:CCGGTCAGTATGAAGTCATTGGTAACTCGAGTTACCAATGACTTCATACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110860    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008640.1-1456s1c1
Sequence:CCGGGCCTTGTCAATAAAGCCTATACTCGAGTATAGGCTTTATTGACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008640.1-1173s1c1
Sequence:CCGGGTTGCCTGATTTCCCATACAACTCGAGTTGTATGGGAAATCAGGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014713
LAPTM4A MISSION shRNA Bacterial Glycerol Stock
lysosomal protein transmembrane 4 alpha
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-991s21c1
Sequence:CCGGCCTGTTCATTGTTCTTGTGTTCTCGAGAACACAAGAACAATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-839s21c1
Sequence:CCGGCCATTCTTCTGTTACCGACTTCTCGAGAAGTCGGTAACAGAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-761s21c1
Sequence:CCGGGCCGTCTCTGTTCTTATGTTTCTCGAGAAACATAAGAACAGAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-898s21c1
Sequence:CCGGTCTCACCTATTTGCCAAGAATCTCGAGATTCTTGGCAAATAGGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-495s1c1
Sequence:CCGGCCATTCTTCTGTTACCGACTTCTCGAGAAGTCGGTAACAGAAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-417s1c1
Sequence:CCGGGCCGTCTCTGTTCTTATGTTTCTCGAGAAACATAAGAACAGAGACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-647s1c1
Sequence:CCGGCCTGTTCATTGTTCTTGTGTTCTCGAGAACACAAGAACAATGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-379s1c1
Sequence:CCGGCGTCTGAGAGAATGGCTGATACTCGAGTATCAGCCATTCTCTCAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-554s1c1
Sequence:CCGGTCTCACCTATTTGCCAAGAATCTCGAGATTCTTGGCAAATAGGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014713
LAPTM4A MISSION shRNA shRNA Plasmid DNA
lysosomal protein transmembrane 4 alpha
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-991s21c1
Sequence:CCGGCCTGTTCATTGTTCTTGTGTTCTCGAGAACACAAGAACAATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-839s21c1
Sequence:CCGGCCATTCTTCTGTTACCGACTTCTCGAGAAGTCGGTAACAGAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-761s21c1
Sequence:CCGGGCCGTCTCTGTTCTTATGTTTCTCGAGAAACATAAGAACAGAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-898s21c1
Sequence:CCGGTCTCACCTATTTGCCAAGAATCTCGAGATTCTTGGCAAATAGGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-495s1c1
Sequence:CCGGCCATTCTTCTGTTACCGACTTCTCGAGAAGTCGGTAACAGAAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-417s1c1
Sequence:CCGGGCCGTCTCTGTTCTTATGTTTCTCGAGAAACATAAGAACAGAGACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-647s1c1
Sequence:CCGGCCTGTTCATTGTTCTTGTGTTCTCGAGAACACAAGAACAATGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-379s1c1
Sequence:CCGGCGTCTGAGAGAATGGCTGATACTCGAGTATCAGCCATTCTCTCAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-554s1c1
Sequence:CCGGTCTCACCTATTTGCCAAGAATCTCGAGATTCTTGGCAAATAGGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014713
LAPTM4A MISSION shRNA Lentiviral Transduction Particles
lysosomal protein transmembrane 4 alpha
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-991s21c1
Sequence:CCGGCCTGTTCATTGTTCTTGTGTTCTCGAGAACACAAGAACAATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-839s21c1
Sequence:CCGGCCATTCTTCTGTTACCGACTTCTCGAGAAGTCGGTAACAGAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-761s21c1
Sequence:CCGGGCCGTCTCTGTTCTTATGTTTCTCGAGAAACATAAGAACAGAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014713.4-898s21c1
Sequence:CCGGTCTCACCTATTTGCCAAGAATCTCGAGATTCTTGGCAAATAGGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-495s1c1
Sequence:CCGGCCATTCTTCTGTTACCGACTTCTCGAGAAGTCGGTAACAGAAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-417s1c1
Sequence:CCGGGCCGTCTCTGTTCTTATGTTTCTCGAGAAACATAAGAACAGAGACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-647s1c1
Sequence:CCGGCCTGTTCATTGTTCTTGTGTTCTCGAGAACACAAGAACAATGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-379s1c1
Sequence:CCGGCGTCTGAGAGAATGGCTGATACTCGAGTATCAGCCATTCTCTCAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014713.3-554s1c1
Sequence:CCGGTCTCACCTATTTGCCAAGAATCTCGAGATTCTTGGCAAATAGGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)