EMAIL THIS PAGE TO A FRIEND

LAPTM4B

lysosomal protein transmembrane 4 beta

110 Gene Product Result for
Synonyms: LAPTM4beta LC27
UniProtKB ID: Q86VI4, Q3ZCV5, Q7L909, Q86VH8, Q9H060
Gene ID:
Mouse(114128) lysosomal-associated protein transmembrane 4B
Rat(315047) lysosomal protein transmembrane 4 beta
sheep(101107107) lysosomal protein transmembrane 4 beta
domestic guinea pig(100730523) lysosomal protein transmembrane 4 beta
naked mole-rat(101711304) lysosomal protein transmembrane 4 beta
Zebrafish(368911) lysosomal associated protein transmembrane 4 beta
dog(475042) lysosomal protein transmembrane 4 beta
cow(404155) lysosomal protein transmembrane 4 beta
domestic cat(101095227) lysosomal protein transmembrane 4 beta
chicken(770893) lysosomal protein transmembrane 4 beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108686 Anti-LAPTM4B affinity isolated antibody mouse, rat, human, horse, rabbit, dog, guinea pig
immunohistochemistry, western blot pricing
SAB1303683 ANTI-LAPTM4B (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
SAB2101317 Anti-LAPTM4B antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, rabbit, horse, bovine, mouse
western blot pricing
HPA068830 Anti-LAPTM4B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018407 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018407 Rosetta Predictions human pricing
NM_001013174 Rosetta Predictions rat pricing
NM_033521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070853 predicted 607
2 SASI_Hs01_00070854 predicted 652
3 SASI_Hs01_00070855 predicted 768
4 SASI_Hs01_00070856 predicted 1156
5 SASI_Hs01_00070857 predicted 947
6 SASI_Hs01_00070859 predicted 732
7 SASI_Hs01_00070860 predicted 744
8 SASI_Hs01_00070861 predicted 857
9 SASI_Hs01_00070862 predicted 891
10 SASI_Hs02_00351914 predicted 598
11 SASI_Hs01_00070858 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055500 predicted 404
2 SASI_Rn01_00055501 predicted 637
3 SASI_Rn01_00055502 predicted 937
4 SASI_Rn01_00055503 predicted 563
5 SASI_Rn01_00055504 predicted 451
6 SASI_Rn01_00055506 predicted 518
7 SASI_Rn01_00055507 predicted 971
8 SASI_Rn01_00055508 predicted 424
9 SASI_Rn01_00055509 predicted 887
10 SASI_Rn02_00200928 predicted 334
11 SASI_Rn01_00055505 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088524 predicted 523
2 SASI_Mm01_00088525 predicted 718
3 SASI_Mm01_00088526 predicted 757
4 SASI_Mm01_00088527 predicted 545
5 SASI_Mm02_00337379 predicted 603
6 SASI_Mm01_00088521 predicted 652
7 SASI_Mm01_00088528 predicted 612
8 SASI_Mm01_00088529 predicted 755
9 SASI_Mm01_00088522 predicted 945
10 SASI_Mm02_00337380 predicted 499
11 SASI_Mm01_00088523 predicted 872
12 SASI_Mm01_00088530 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018407
VALIDATED
LAPTM4B MISSION shRNA Bacterial Glycerol Stock
lysosomal protein transmembrane 4 beta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-1997s1c1
Sequence:CCGGGCAAGCTACATCCTACTGCTTCTCGAGAAGCAGTAGGATGTAGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-516s1c1
Sequence:CCGGCGTCTGGTATCTGATCATCAACTCGAGTTGATGATCAGATACCAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-1002s1c1
Sequence:CCGGCCTGGTTTATGTTACCAGCAACTCGAGTTGCTGGTAACATAAACCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018407.3-1281s1c1
Sequence:CCGGGCTGGAACACTGTGATAGATTCTCGAGAATCTATCACAGTGTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-1376s21c1
Sequence:CCGGCCAAATCTGATGGACCTAGAACTCGAGTTCTAGGTCCATCAGATTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-1997s21c1
Sequence:CCGGGCAAGCTACATCCTACTGCTTCTCGAGAAGCAGTAGGATGTAGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-768s1c1
Sequence:CCGGCCTGAACATGTTGGTTGCAATCTCGAGATTGCAACCAACATGTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-859s1c1
Sequence:CCGGGATGATGTCATGTCAGTGAATCTCGAGATTCACTGACATGACATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-681s1c1
Sequence:CCGGGATATGTGCTATGGCTACTTACTCGAGTAAGTAGCCATAGCACATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-1376s1c1
Sequence:CCGGCCAAATCTGATGGACCTAGAACTCGAGTTCTAGGTCCATCAGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-681s21c1
Sequence:CCGGGATATGTGCTATGGCTACTTACTCGAGTAAGTAGCCATAGCACATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-859s21c1
Sequence:CCGGGATGATGTCATGTCAGTGAATCTCGAGATTCACTGACATGACATCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018407
VALIDATED
LAPTM4B MISSION shRNA shRNA Plasmid DNA
lysosomal protein transmembrane 4 beta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-1997s1c1
Sequence:CCGGGCAAGCTACATCCTACTGCTTCTCGAGAAGCAGTAGGATGTAGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-516s1c1
Sequence:CCGGCGTCTGGTATCTGATCATCAACTCGAGTTGATGATCAGATACCAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-1002s1c1
Sequence:CCGGCCTGGTTTATGTTACCAGCAACTCGAGTTGCTGGTAACATAAACCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018407.3-1281s1c1
Sequence:CCGGGCTGGAACACTGTGATAGATTCTCGAGAATCTATCACAGTGTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-1376s21c1
Sequence:CCGGCCAAATCTGATGGACCTAGAACTCGAGTTCTAGGTCCATCAGATTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-1997s21c1
Sequence:CCGGGCAAGCTACATCCTACTGCTTCTCGAGAAGCAGTAGGATGTAGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-768s1c1
Sequence:CCGGCCTGAACATGTTGGTTGCAATCTCGAGATTGCAACCAACATGTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-859s1c1
Sequence:CCGGGATGATGTCATGTCAGTGAATCTCGAGATTCACTGACATGACATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-681s1c1
Sequence:CCGGGATATGTGCTATGGCTACTTACTCGAGTAAGTAGCCATAGCACATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-1376s1c1
Sequence:CCGGCCAAATCTGATGGACCTAGAACTCGAGTTCTAGGTCCATCAGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-681s21c1
Sequence:CCGGGATATGTGCTATGGCTACTTACTCGAGTAAGTAGCCATAGCACATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-859s21c1
Sequence:CCGGGATGATGTCATGTCAGTGAATCTCGAGATTCACTGACATGACATCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018407
VALIDATED
LAPTM4B MISSION shRNA Lentiviral Transduction Particles
lysosomal protein transmembrane 4 beta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157569    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-1997s1c1
Sequence:CCGGGCAAGCTACATCCTACTGCTTCTCGAGAAGCAGTAGGATGTAGCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-516s1c1
Sequence:CCGGCGTCTGGTATCTGATCATCAACTCGAGTTGATGATCAGATACCAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-1002s1c1
Sequence:CCGGCCTGGTTTATGTTACCAGCAACTCGAGTTGCTGGTAACATAAACCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154509    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018407.3-1281s1c1
Sequence:CCGGGCTGGAACACTGTGATAGATTCTCGAGAATCTATCACAGTGTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297942    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-1376s21c1
Sequence:CCGGCCAAATCTGATGGACCTAGAACTCGAGTTCTAGGTCCATCAGATTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281163    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-1997s21c1
Sequence:CCGGGCAAGCTACATCCTACTGCTTCTCGAGAAGCAGTAGGATGTAGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018407.3-768s1c1
Sequence:CCGGCCTGAACATGTTGGTTGCAATCTCGAGATTGCAACCAACATGTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-859s1c1
Sequence:CCGGGATGATGTCATGTCAGTGAATCTCGAGATTCACTGACATGACATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-681s1c1
Sequence:CCGGGATATGTGCTATGGCTACTTACTCGAGTAAGTAGCCATAGCACATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155874    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_018407.3-1376s1c1
Sequence:CCGGCCAAATCTGATGGACCTAGAACTCGAGTTCTAGGTCCATCAGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-681s21c1
Sequence:CCGGGATATGTGCTATGGCTACTTACTCGAGTAAGTAGCCATAGCACATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018407.4-859s21c1
Sequence:CCGGGATGATGTCATGTCAGTGAATCTCGAGATTCACTGACATGACATCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033521
VALIDATED
LAPTM4B MISSION shRNA Bacterial Glycerol Stock
lysosomal protein transmembrane 4 beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033521.2-807s1c1
Sequence:CCGGGCTACTTGATTAGCTGCGTTTCTCGAGAAACGCAGCTAATCAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-714s21c1
Sequence:CCGGGCTTTCCCTACAGAGATGATACTCGAGTATCATCTCTGTAGGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033521.3-1027s21c1
Sequence:CCGGGCATGAATTATCCTGTGGTTTCTCGAGAAACCACAGGATAATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-749s21c1
Sequence:CCGGCCTACCTGTTTGGTCCTTATTCTCGAGAATAAGGACCAAACAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-749s1c1
Sequence:CCGGCCTACCTGTTTGGTCCTTATTCTCGAGAATAAGGACCAAACAGGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-1027s1c1
Sequence:CCGGGCATGAATTATCCTGTGGTTTCTCGAGAAACCACAGGATAATTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-604s1c1
Sequence:CCGGCCCGTTCTTCTGTTACCAGATCTCGAGATCTGGTAACAGAAGAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033521.2-714s1c1
Sequence:CCGGGCTTTCCCTACAGAGATGATACTCGAGTATCATCTCTGTAGGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-604s21c1
Sequence:CCGGCCCGTTCTTCTGTTACCAGATCTCGAGATCTGGTAACAGAAGAACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033521
VALIDATED
LAPTM4B MISSION shRNA shRNA Plasmid DNA
lysosomal protein transmembrane 4 beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033521.2-807s1c1
Sequence:CCGGGCTACTTGATTAGCTGCGTTTCTCGAGAAACGCAGCTAATCAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-714s21c1
Sequence:CCGGGCTTTCCCTACAGAGATGATACTCGAGTATCATCTCTGTAGGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033521.3-1027s21c1
Sequence:CCGGGCATGAATTATCCTGTGGTTTCTCGAGAAACCACAGGATAATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-749s21c1
Sequence:CCGGCCTACCTGTTTGGTCCTTATTCTCGAGAATAAGGACCAAACAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-749s1c1
Sequence:CCGGCCTACCTGTTTGGTCCTTATTCTCGAGAATAAGGACCAAACAGGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-1027s1c1
Sequence:CCGGGCATGAATTATCCTGTGGTTTCTCGAGAAACCACAGGATAATTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-604s1c1
Sequence:CCGGCCCGTTCTTCTGTTACCAGATCTCGAGATCTGGTAACAGAAGAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033521.2-714s1c1
Sequence:CCGGGCTTTCCCTACAGAGATGATACTCGAGTATCATCTCTGTAGGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-604s21c1
Sequence:CCGGCCCGTTCTTCTGTTACCAGATCTCGAGATCTGGTAACAGAAGAACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033521
VALIDATED
LAPTM4B MISSION shRNA Lentiviral Transduction Particles
lysosomal protein transmembrane 4 beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033521.2-807s1c1
Sequence:CCGGGCTACTTGATTAGCTGCGTTTCTCGAGAAACGCAGCTAATCAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-714s21c1
Sequence:CCGGGCTTTCCCTACAGAGATGATACTCGAGTATCATCTCTGTAGGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033521.3-1027s21c1
Sequence:CCGGGCATGAATTATCCTGTGGTTTCTCGAGAAACCACAGGATAATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-749s21c1
Sequence:CCGGCCTACCTGTTTGGTCCTTATTCTCGAGAATAAGGACCAAACAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-749s1c1
Sequence:CCGGCCTACCTGTTTGGTCCTTATTCTCGAGAATAAGGACCAAACAGGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110795    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-1027s1c1
Sequence:CCGGGCATGAATTATCCTGTGGTTTCTCGAGAAACCACAGGATAATTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033521.2-604s1c1
Sequence:CCGGCCCGTTCTTCTGTTACCAGATCTCGAGATCTGGTAACAGAAGAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033521.2-714s1c1
Sequence:CCGGGCTTTCCCTACAGAGATGATACTCGAGTATCATCTCTGTAGGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033521.3-604s21c1
Sequence:CCGGCCCGTTCTTCTGTTACCAGATCTCGAGATCTGGTAACAGAAGAACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)